EMAIL THIS PAGE TO A FRIEND

WSB2

WD repeat and SOCS box containing 2

Synonyms: SBA2
UniProtKB ID: Q9NYS7, Q9NRX9
Gene ID:
Human(55884) Summary: This gene encodes a member of the WD-protein subfamily. The encoded protein contains five WD-repeats spanning most of the protein and an SOCS box in the C-terminus. The SOCS box may act as a bridge between specific substrate-binding domains and E3 ubiquitin protein ligases. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
Mouse(59043) WD repeat and SOCS box-containing 2
Rat(288692) WD repeat and SOCS box-containing 2
domestic guinea pig(100731887) WD repeat and SOCS box containing 2
naked mole-rat(101709241) WD repeat and SOCS box containing 2
Domestic Rabbit(100345110) WD repeat and SOCS box containing 2
cow(508388) WD repeat and SOCS box containing 2
sheep(100499499) WD repeat and SOCS box containing 2
Zebrafish(100307075) WD repeat and SOCS box-containing 2
dog(477500) WD repeat and SOCS box containing 2
domestic cat(101092549) WD repeat and SOCS box containing 2
chicken(417023) WD repeat and SOCS box containing 2
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021539 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021539 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021539 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018639 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018639 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018639 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018639 Rosetta Predictions human pricing
NM_001007616 Rosetta Predictions rat pricing
NM_021539 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352136 predicted 1369
2 SASI_Hs01_00045099 predicted 615
3 SASI_Hs01_00045100 predicted 1337
4 SASI_Hs01_00045101 predicted 970
5 SASI_Hs01_00045104 predicted 738
6 SASI_Hs01_00045105 predicted 783
7 SASI_Hs01_00045106 predicted 652
8 SASI_Hs01_00045107 predicted 1245
9 SASI_Hs01_00045108 predicted 863
10 SASI_Hs02_00352137 predicted 642
11 SASI_Hs01_00045102 predicted 696
12 SASI_Hs01_00045103 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007616 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048788 predicted 752
2 SASI_Rn01_00048789 predicted 253
3 SASI_Rn01_00048790 predicted 445
4 SASI_Rn01_00048792 predicted 603
5 SASI_Rn01_00048793 predicted 746
6 SASI_Rn01_00048794 predicted 1310
7 SASI_Rn01_00048795 predicted 589
8 SASI_Rn01_00048796 predicted 757
9 SASI_Rn01_00048797 predicted 1211
10 SASI_Rn02_00198706 predicted 538
11 SASI_Rn01_00048791 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050144 predicted 711
2 SASI_Mm01_00050145 predicted 667
3 SASI_Mm01_00050147 predicted 1068
4 SASI_Mm01_00050148 predicted 392
5 SASI_Mm01_00050149 predicted 1159
6 SASI_Mm01_00050150 predicted 742
7 SASI_Mm01_00050152 predicted 893
8 SASI_Mm02_00326281 predicted 535
9 SASI_Mm02_00326282 predicted 868
10 SASI_Mm02_00326283 predicted 335
11 SASI_Mm01_00050143 predicted 928
12 SASI_Mm01_00050146 predicted 1410
13 SASI_Mm01_00050151 predicted 933
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021539
VALIDATED
WSB2 MISSION shRNA Bacterial Glycerol Stock
WD repeat and SOCS box containing 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021539.3-1868s1c1
Sequence:CCGGCAAGCGAGTATTCAGATCATACTCGAGTATGATCTGAATACTCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021539.3-328s1c1
Sequence:CCGGGAGGAACAGTTCATCCCTAAACTCGAGTTTAGGGATGAACTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021539.3-1158s1c1
Sequence:CCGGCAATGGTCTTTGCTGCACGTTCTCGAGAACGTGCAGCAAAGACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021539.3-875s1c1
Sequence:CCGGGCAGTGTTGTCTCCTGTGATTCTCGAGAATCACAGGAGACAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021539
VALIDATED
WSB2 MISSION shRNA shRNA Plasmid DNA
WD repeat and SOCS box containing 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021539.3-1868s1c1
Sequence:CCGGCAAGCGAGTATTCAGATCATACTCGAGTATGATCTGAATACTCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021539.3-328s1c1
Sequence:CCGGGAGGAACAGTTCATCCCTAAACTCGAGTTTAGGGATGAACTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021539.3-1158s1c1
Sequence:CCGGCAATGGTCTTTGCTGCACGTTCTCGAGAACGTGCAGCAAAGACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021539.3-875s1c1
Sequence:CCGGGCAGTGTTGTCTCCTGTGATTCTCGAGAATCACAGGAGACAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021539
VALIDATED
WSB2 MISSION shRNA Lentiviral Transduction Particles
WD repeat and SOCS box containing 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021539.3-1868s1c1
Sequence:CCGGCAAGCGAGTATTCAGATCATACTCGAGTATGATCTGAATACTCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021539.3-328s1c1
Sequence:CCGGGAGGAACAGTTCATCCCTAAACTCGAGTTTAGGGATGAACTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021539.3-1158s1c1
Sequence:CCGGCAATGGTCTTTGCTGCACGTTCTCGAGAACGTGCAGCAAAGACCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021539.3-875s1c1
Sequence:CCGGGCAGTGTTGTCTCCTGTGATTCTCGAGAATCACAGGAGACAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018639
VALIDATED
WSB2 MISSION shRNA Bacterial Glycerol Stock
WD repeat and SOCS box containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018639.3-1927s1c1
Sequence:CCGGCCAGACACTATTACTGGCTTTCTCGAGAAAGCCAGTAATAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018639.3-1225s1c1
Sequence:CCGGCCCTTCGAAGTTTCCTAACAACTCGAGTTGTTAGGAAACTTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018639.3-863s1c1
Sequence:CCGGCACGGCTTCTTACGATACCAACTCGAGTTGGTATCGTAAGAAGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018639.3-151s1c1
Sequence:CCGGCCCACCAGTTTGATTGGAAGTCTCGAGACTTCCAATCAAACTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018639.3-656s1c1
Sequence:CCGGCGGTAAACAGATTCAAGTGTTCTCGAGAACACTTGAATCTGTTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018639.3-863s21c1
Sequence:CCGGCACGGCTTCTTACGATACCAACTCGAGTTGGTATCGTAAGAAGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018639.3-1927s21c1
Sequence:CCGGCCAGACACTATTACTGGCTTTCTCGAGAAAGCCAGTAATAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018639.3-151s21c1
Sequence:CCGGCCCACCAGTTTGATTGGAAGTCTCGAGACTTCCAATCAAACTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018639.3-1225s21c1
Sequence:CCGGCCCTTCGAAGTTTCCTAACAACTCGAGTTGTTAGGAAACTTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018639.3-656s21c1
Sequence:CCGGCGGTAAACAGATTCAAGTGTTCTCGAGAACACTTGAATCTGTTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018639
VALIDATED
WSB2 MISSION shRNA shRNA Plasmid DNA
WD repeat and SOCS box containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018639.3-1927s1c1
Sequence:CCGGCCAGACACTATTACTGGCTTTCTCGAGAAAGCCAGTAATAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018639.3-1225s1c1
Sequence:CCGGCCCTTCGAAGTTTCCTAACAACTCGAGTTGTTAGGAAACTTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018639.3-863s1c1
Sequence:CCGGCACGGCTTCTTACGATACCAACTCGAGTTGGTATCGTAAGAAGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018639.3-151s1c1
Sequence:CCGGCCCACCAGTTTGATTGGAAGTCTCGAGACTTCCAATCAAACTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018639.3-656s1c1
Sequence:CCGGCGGTAAACAGATTCAAGTGTTCTCGAGAACACTTGAATCTGTTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018639.3-863s21c1
Sequence:CCGGCACGGCTTCTTACGATACCAACTCGAGTTGGTATCGTAAGAAGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018639.3-1927s21c1
Sequence:CCGGCCAGACACTATTACTGGCTTTCTCGAGAAAGCCAGTAATAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018639.3-151s21c1
Sequence:CCGGCCCACCAGTTTGATTGGAAGTCTCGAGACTTCCAATCAAACTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018639.3-1225s21c1
Sequence:CCGGCCCTTCGAAGTTTCCTAACAACTCGAGTTGTTAGGAAACTTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018639.3-656s21c1
Sequence:CCGGCGGTAAACAGATTCAAGTGTTCTCGAGAACACTTGAATCTGTTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018639
VALIDATED
WSB2 MISSION shRNA Lentiviral Transduction Particles
WD repeat and SOCS box containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018639.3-1927s1c1
Sequence:CCGGCCAGACACTATTACTGGCTTTCTCGAGAAAGCCAGTAATAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018639.3-1225s1c1
Sequence:CCGGCCCTTCGAAGTTTCCTAACAACTCGAGTTGTTAGGAAACTTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018639.3-863s1c1
Sequence:CCGGCACGGCTTCTTACGATACCAACTCGAGTTGGTATCGTAAGAAGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018639.3-151s1c1
Sequence:CCGGCCCACCAGTTTGATTGGAAGTCTCGAGACTTCCAATCAAACTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018639.3-656s1c1
Sequence:CCGGCGGTAAACAGATTCAAGTGTTCTCGAGAACACTTGAATCTGTTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018639.3-863s21c1
Sequence:CCGGCACGGCTTCTTACGATACCAACTCGAGTTGGTATCGTAAGAAGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_018639.3-1927s21c1
Sequence:CCGGCCAGACACTATTACTGGCTTTCTCGAGAAAGCCAGTAATAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018639.3-151s21c1
Sequence:CCGGCCCACCAGTTTGATTGGAAGTCTCGAGACTTCCAATCAAACTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018639.3-1225s21c1
Sequence:CCGGCCCTTCGAAGTTTCCTAACAACTCGAGTTGTTAGGAAACTTCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018639.3-656s21c1
Sequence:CCGGCGGTAAACAGATTCAAGTGTTCTCGAGAACACTTGAATCTGTTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks