EMAIL THIS PAGE TO A FRIEND

WSCD2

WSC domain containing 2

UniProtKB ID: Q2TBF2, B2RN48, Q8IY35, Q9Y4B7
Gene ID:
Mouse(320916) WSC domain containing 2
Rat(360824) WSC domain containing 2
Zebrafish(561091) WSC domain containing 2
Horse(100066971) WSC domain containing 2
domestic cat(101089399) WSC domain containing 2
dog(486322) WSC domain containing 2
chicken(416887) WSC domain containing 2
domestic guinea pig(100713877) WSC domain containing 2
naked mole-rat(101711130) WSC domain containing 2
cow(525243) WSC domain containing 2
sheep(101104094) WSC domain containing 2
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014653 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014653 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014653 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177292 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177292 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177292 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073691 MISSION® esiRNA esiRNA human WSCD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014653 Rosetta Predictions human pricing
XM_001080476 Rosetta Predictions rat pricing
XR_005545 Rosetta Predictions rat pricing
NM_177292 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015180 predicted 2429
2 SASI_Hs01_00015181 predicted 1835
3 SASI_Hs02_00345979 predicted 1499
4 SASI_Hs01_00015182 predicted 753
5 SASI_Hs02_00345980 predicted 2389
6 SASI_Hs01_00015183 predicted 1678
7 SASI_Hs02_00345981 predicted 1498
8 SASI_Hs01_00015184 predicted 2088
9 SASI_Hs02_00345982 predicted 2387
10 SASI_Hs01_00015186 predicted 2028
11 SASI_Hs01_00015179 predicted 1122
12 SASI_Hs01_00015185 predicted 1725
13 SASI_Hs01_00015187 predicted 1696
14 SASI_Hs01_00015188 predicted 1888
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080476 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368091 predicted 629
2 SASI_Rn02_00368092 predicted 719
3 SASI_Rn02_00368093 predicted 834
4 SASI_Rn02_00368094 predicted 253
5 SASI_Rn02_00368095 predicted 295
6 SASI_Rn02_00368096 predicted 340
7 SASI_Rn02_00368097 predicted 280
8 SASI_Rn02_00368098 predicted 569
9 SASI_Rn02_00368099 predicted 605
10 SASI_Rn02_00368100 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005545 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00151334 predicted 263
2 SASI_Rn01_00151335 predicted 218
3 SASI_Rn01_00151336 predicted 310
4 SASI_Rn01_00151337 predicted 248
5 SASI_Rn01_00151338 predicted 329
6 SASI_Rn01_00151339 predicted 279
7 SASI_Rn01_00151340 predicted 211
8 SASI_Rn01_00151341 predicted 273
9 SASI_Rn02_00409646 predicted 325
10 SASI_Rn02_00409647 predicted 201
11 SASI_Rn01_00151332 predicted 352
12 SASI_Rn01_00151333 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175998 predicted 1623
2 SASI_Mm01_00175999 predicted 1236
3 SASI_Mm01_00176000 predicted 1192
4 SASI_Mm01_00176001 predicted 1641
5 SASI_Mm01_00176002 predicted 1642
6 SASI_Mm01_00176003 predicted 1721
7 SASI_Mm01_00176004 predicted 1703
8 SASI_Mm01_00176005 predicted 1203
9 SASI_Mm01_00176006 predicted 1739
10 SASI_Mm01_00176007 predicted 1581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014653
WSCD2 MISSION shRNA Bacterial Glycerol Stock
WSC domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014653.2-1422s1c1
Sequence:CCGGCAGGTATGGAAGTGCAGTGTTCTCGAGAACACTGCACTTCCATACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014653.2-2946s1c1
Sequence:CCGGCCTTCTGTTCTAAAGAAAGATCTCGAGATCTTTCTTTAGAACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014653.2-2943s1c1
Sequence:CCGGCCACCTTCTGTTCTAAAGAAACTCGAGTTTCTTTAGAACAGAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014653.2-3593s1c1
Sequence:CCGGGCATCAATCTTACAAAGTGTTCTCGAGAACACTTTGTAAGATTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014653.2-2280s1c1
Sequence:CCGGCCAGAAGGATGGCAACTTCAACTCGAGTTGAAGTTGCCATCCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014653.2-2365s1c1
Sequence:CCGGGCCTACATCAAGATGGTGGATCTCGAGATCCACCATCTTGATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014653.2-1682s21c1
Sequence:CCGGGGACTCCTAGTTACTTCATTGCTCGAGCAATGAAGTAACTAGGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014653.2-2866s21c1
Sequence:CCGGGTCCCTTCTGGGCTGAGATTTCTCGAGAAATCTCAGCCCAGAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014653.2-2914s21c1
Sequence:CCGGGAAGTGCTGGCACCGATGTTTCTCGAGAAACATCGGTGCCAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014653.2-1932s21c1
Sequence:CCGGCTGCATCAAGACGCACGAAAGCTCGAGCTTTCGTGCGTCTTGATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014653
WSCD2 MISSION shRNA shRNA Plasmid DNA
WSC domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014653.2-1422s1c1
Sequence:CCGGCAGGTATGGAAGTGCAGTGTTCTCGAGAACACTGCACTTCCATACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014653.2-2946s1c1
Sequence:CCGGCCTTCTGTTCTAAAGAAAGATCTCGAGATCTTTCTTTAGAACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014653.2-2943s1c1
Sequence:CCGGCCACCTTCTGTTCTAAAGAAACTCGAGTTTCTTTAGAACAGAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014653.2-3593s1c1
Sequence:CCGGGCATCAATCTTACAAAGTGTTCTCGAGAACACTTTGTAAGATTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014653.2-2280s1c1
Sequence:CCGGCCAGAAGGATGGCAACTTCAACTCGAGTTGAAGTTGCCATCCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014653.2-2365s1c1
Sequence:CCGGGCCTACATCAAGATGGTGGATCTCGAGATCCACCATCTTGATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014653.2-1682s21c1
Sequence:CCGGGGACTCCTAGTTACTTCATTGCTCGAGCAATGAAGTAACTAGGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014653.2-2866s21c1
Sequence:CCGGGTCCCTTCTGGGCTGAGATTTCTCGAGAAATCTCAGCCCAGAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014653.2-2914s21c1
Sequence:CCGGGAAGTGCTGGCACCGATGTTTCTCGAGAAACATCGGTGCCAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014653.2-1932s21c1
Sequence:CCGGCTGCATCAAGACGCACGAAAGCTCGAGCTTTCGTGCGTCTTGATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014653
WSCD2 MISSION shRNA Lentiviral Transduction Particles
WSC domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014653.2-1422s1c1
Sequence:CCGGCAGGTATGGAAGTGCAGTGTTCTCGAGAACACTGCACTTCCATACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014653.2-2946s1c1
Sequence:CCGGCCTTCTGTTCTAAAGAAAGATCTCGAGATCTTTCTTTAGAACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014653.2-2943s1c1
Sequence:CCGGCCACCTTCTGTTCTAAAGAAACTCGAGTTTCTTTAGAACAGAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014653.2-3593s1c1
Sequence:CCGGGCATCAATCTTACAAAGTGTTCTCGAGAACACTTTGTAAGATTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014653.2-2280s1c1
Sequence:CCGGCCAGAAGGATGGCAACTTCAACTCGAGTTGAAGTTGCCATCCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014653.2-2365s1c1
Sequence:CCGGGCCTACATCAAGATGGTGGATCTCGAGATCCACCATCTTGATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014653.2-1682s21c1
Sequence:CCGGGGACTCCTAGTTACTTCATTGCTCGAGCAATGAAGTAACTAGGAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014653.2-2866s21c1
Sequence:CCGGGTCCCTTCTGGGCTGAGATTTCTCGAGAAATCTCAGCCCAGAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014653.2-2914s21c1
Sequence:CCGGGAAGTGCTGGCACCGATGTTTCTCGAGAAACATCGGTGCCAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014653.2-1932s21c1
Sequence:CCGGCTGCATCAAGACGCACGAAAGCTCGAGCTTTCGTGCGTCTTGATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177292
WSCD2 MISSION shRNA Bacterial Glycerol Stock
WSC domain containing 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177292.2-1200s1c1
Sequence:CCGGGACATTGGACTTGTCATCCATCTCGAGATGGATGACAAGTCCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177292.2-3975s1c1
Sequence:CCGGGCAGTAACAATGCCGTTTATTCTCGAGAATAAACGGCATTGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177292.2-1228s1c1
Sequence:CCGGGAGTCACACAGCTACTCCTTACTCGAGTAAGGAGTAGCTGTGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177292.2-1244s1c1
Sequence:CCGGCCTTAATTGGCAAGTTCCATTCTCGAGAATGGAACTTGCCAATTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177292
WSCD2 MISSION shRNA shRNA Plasmid DNA
WSC domain containing 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177292.2-1200s1c1
Sequence:CCGGGACATTGGACTTGTCATCCATCTCGAGATGGATGACAAGTCCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177292.2-3975s1c1
Sequence:CCGGGCAGTAACAATGCCGTTTATTCTCGAGAATAAACGGCATTGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177292.2-1228s1c1
Sequence:CCGGGAGTCACACAGCTACTCCTTACTCGAGTAAGGAGTAGCTGTGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177292.2-1244s1c1
Sequence:CCGGCCTTAATTGGCAAGTTCCATTCTCGAGAATGGAACTTGCCAATTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177292
WSCD2 MISSION shRNA Lentiviral Transduction Particles
WSC domain containing 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177292.2-1200s1c1
Sequence:CCGGGACATTGGACTTGTCATCCATCTCGAGATGGATGACAAGTCCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177292.2-3975s1c1
Sequence:CCGGGCAGTAACAATGCCGTTTATTCTCGAGAATAAACGGCATTGTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177292.2-1228s1c1
Sequence:CCGGGAGTCACACAGCTACTCCTTACTCGAGTAAGGAGTAGCTGTGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177292.2-1244s1c1
Sequence:CCGGCCTTAATTGGCAAGTTCCATTCTCGAGAATGGAACTTGCCAATTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks