EMAIL THIS PAGE TO A FRIEND

WT1-AS

WT1 antisense RNA

Synonyms: WIT-1 WIT1 WT1-AS1 WT1AS dJ74J1.1
Species: Human WT1-AS(51352)
UniProtKB ID: Q06250, Q4KMY0, Q96A27
Gene ID:
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304598 ANTI-WIT1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015855 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130991 MISSION® esiRNA esiRNA human WIT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015855 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070263 predicted 1026
2 SASI_Hs01_00070264 predicted 1022
3 SASI_Hs01_00070265 predicted 1021
4 SASI_Hs01_00070266 predicted 1017
5 SASI_Hs01_00070267 predicted 795
6 SASI_Hs01_00070268 predicted 831
7 SASI_Hs01_00070269 predicted 823
8 SASI_Hs01_00070270 predicted 1235
9 SASI_Hs01_00070271 predicted 1445
10 SASI_Hs01_00070272 predicted 1759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015855
WT1-AS MISSION shRNA Bacterial Glycerol Stock
WT1 antisense RNA
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015855.2-1081s1c1
Sequence:CCGGCAGTGAGGATTTCTCAACCCTCTCGAGAGGGTTGAGAAATCCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015855.2-1024s1c1
Sequence:CCGGCCTCGAAGGTGCATAATTATTCTCGAGAATAATTATGCACCTTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150893    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015855.2-1088s1c1
Sequence:CCGGGATTTCTCAACCCTTACTTTCCTCGAGGAAAGTAAGGGTTGAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015855.2-1970s1c1
Sequence:CCGGCCCATGAAATTGATGAACTGACTCGAGTCAGTTCATCAATTTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015855.2-1027s1c1
Sequence:CCGGCGAAGGTGCATAATTATTGCACTCGAGTGCAATAATTATGCACCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015855.2-1085s1c1
Sequence:CCGGGAGGATTTCTCAACCCTTACTCTCGAGAGTAAGGGTTGAGAAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015855.2-1577s1c1
Sequence:CCGGGATAACTACTCCCAGCTTCTTCTCGAGAAGAAGCTGGGAGTAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154532    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015855.2-1808s1c1
Sequence:CCGGGAGAGTCCTCAGTGAAAGGATCTCGAGATCCTTTCACTGAGGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015855.2-1587s1c1
Sequence:CCGGCCCAGCTTCTTCTGATCATTTCTCGAGAAATGATCAGAAGAAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015855.2-1833s1c1
Sequence:CCGGCGGCACTGCCTCTATTATTATCTCGAGATAATAATAGAGGCAGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015855.2-1570s1c1
Sequence:CCGGGCTTTGTGATAACTACTCCCACTCGAGTGGGAGTAGTTATCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015855
WT1-AS MISSION shRNA shRNA Plasmid DNA
WT1 antisense RNA
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015855.2-1081s1c1
Sequence:CCGGCAGTGAGGATTTCTCAACCCTCTCGAGAGGGTTGAGAAATCCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015855.2-1024s1c1
Sequence:CCGGCCTCGAAGGTGCATAATTATTCTCGAGAATAATTATGCACCTTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150893    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015855.2-1088s1c1
Sequence:CCGGGATTTCTCAACCCTTACTTTCCTCGAGGAAAGTAAGGGTTGAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015855.2-1970s1c1
Sequence:CCGGCCCATGAAATTGATGAACTGACTCGAGTCAGTTCATCAATTTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015855.2-1027s1c1
Sequence:CCGGCGAAGGTGCATAATTATTGCACTCGAGTGCAATAATTATGCACCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015855.2-1085s1c1
Sequence:CCGGGAGGATTTCTCAACCCTTACTCTCGAGAGTAAGGGTTGAGAAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015855.2-1577s1c1
Sequence:CCGGGATAACTACTCCCAGCTTCTTCTCGAGAAGAAGCTGGGAGTAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154532    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015855.2-1808s1c1
Sequence:CCGGGAGAGTCCTCAGTGAAAGGATCTCGAGATCCTTTCACTGAGGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015855.2-1587s1c1
Sequence:CCGGCCCAGCTTCTTCTGATCATTTCTCGAGAAATGATCAGAAGAAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015855.2-1833s1c1
Sequence:CCGGCGGCACTGCCTCTATTATTATCTCGAGATAATAATAGAGGCAGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015855.2-1570s1c1
Sequence:CCGGGCTTTGTGATAACTACTCCCACTCGAGTGGGAGTAGTTATCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015855
WT1-AS MISSION shRNA Lentiviral Transduction Particles
WT1 antisense RNA
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015855.2-1081s1c1
Sequence:CCGGCAGTGAGGATTTCTCAACCCTCTCGAGAGGGTTGAGAAATCCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015855.2-1024s1c1
Sequence:CCGGCCTCGAAGGTGCATAATTATTCTCGAGAATAATTATGCACCTTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150893    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015855.2-1088s1c1
Sequence:CCGGGATTTCTCAACCCTTACTTTCCTCGAGGAAAGTAAGGGTTGAGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015855.2-1970s1c1
Sequence:CCGGCCCATGAAATTGATGAACTGACTCGAGTCAGTTCATCAATTTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015855.2-1027s1c1
Sequence:CCGGCGAAGGTGCATAATTATTGCACTCGAGTGCAATAATTATGCACCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015855.2-1085s1c1
Sequence:CCGGGAGGATTTCTCAACCCTTACTCTCGAGAGTAAGGGTTGAGAAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015855.2-1577s1c1
Sequence:CCGGGATAACTACTCCCAGCTTCTTCTCGAGAAGAAGCTGGGAGTAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154532    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015855.2-1808s1c1
Sequence:CCGGGAGAGTCCTCAGTGAAAGGATCTCGAGATCCTTTCACTGAGGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015855.2-1587s1c1
Sequence:CCGGCCCAGCTTCTTCTGATCATTTCTCGAGAAATGATCAGAAGAAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015855.2-1833s1c1
Sequence:CCGGCGGCACTGCCTCTATTATTATCTCGAGATAATAATAGAGGCAGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015855.2-1570s1c1
Sequence:CCGGGCTTTGTGATAACTACTCCCACTCGAGTGGGAGTAGTTATCACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks