EMAIL THIS PAGE TO A FRIEND

WT1

Wilms tumor 1

Synonyms: AWT1 EWS-WT1 GUD NPHS4 WAGR WIT-2 WT33
Gene ID:
Human(7490) Summary: This gene encodes a transcription factor that contains four zinc-finger motifs at the C-terminus and a proline/glutamine-rich DNA-binding domain at the N-terminus. It has an essential role in the normal development of the urogenital system, and it is mutated in a small subset of patients with Wilm's tumors. This gene exhibits complex tissue-specific and polymorphic imprinting pattern, with biallelic, and monoallelic expression from the maternal and paternal alleles in different tissues. Multiple transcript variants have been described. In several variants, there is evidence for the use of a non-AUG (CUG) translation initiation site upstream of and in-frame with the first AUG. Authors of PMID:7926762 also provide evidence that WT1 mRNA undergoes RNA editing in human and rat, and that this process is tissue-restricted and developmentally regulated. [provided by RefSeq, Oct 2010]
Mouse(22431) Wilms tumor 1 homolog
Rat(24883) Wilms tumor 1
cow(614584) Wilms tumor 1
cow(782183) Wilms tumor 1
cow(280959) Wilms tumor 1
sheep(100101227) Wilms tumor 1
chicken(396139) Wilms tumor 1
dog(609253) Wilms tumor 1
domestic cat(101088518) Wilms tumor 1
181 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501111 Anti-WILMS Tumor 1/WT1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB2108752 Anti-WT1 affinity isolated antibody human, rat, bovine, pig, mouse, canine, rabbit, horse, zebrafish
immunohistochemistry, western blot pricing
SAB2102716 Anti-WT1 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2104329 Anti-WT1 antibody produced in rabbit affinity isolated antibody rat, rabbit, zebrafish, pig, human, horse, canine, mouse
western blot pricing
SAB1411399 Anti-WT1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA035717 Anti-WT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA053848 Anti-WT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0007490M1 Monoclonal Anti-WT1 antibody produced in mouse clone 2H4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404530 Monoclonal Anti-WT1 antibody produced in mouse clone 3B12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409794 Monoclonal Anti-WT1 antibody produced in mouse clone 1A12, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409795 Monoclonal Anti-WT1 antibody produced in mouse clone 1E2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409796 Monoclonal Anti-WT1 antibody produced in mouse clone 1E9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024426 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024424 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083661 MISSION® esiRNA esiRNA human WT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000378 Rosetta Predictions human pricing
NM_024424 Rosetta Predictions human pricing
NM_024425 Rosetta Predictions human pricing
NM_024426 Rosetta Predictions human pricing
NM_031534 Rosetta Predictions rat pricing
NM_144783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130272 predicted 2120
2 SASI_Hs01_00130273 predicted 1857
3 SASI_Hs01_00130274 predicted 1814
4 SASI_Hs01_00130275 predicted 1915
5 SASI_Hs01_00130276 predicted 2033
6 SASI_Hs01_00130277 predicted 912
7 SASI_Hs01_00130278 predicted 1773
8 SASI_Hs01_00130279 predicted 2093
9 SASI_Hs01_00130280 predicted 842
10 SASI_Hs02_00302437 predicted 823
11 SASI_Hs01_00130271 predicted 1917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130692 predicted 2171
2 SASI_Hs01_00130693 predicted 1910
3 SASI_Hs01_00130694 predicted 1870
4 SASI_Hs01_00130695 predicted 1957
5 SASI_Hs01_00130696 predicted 2091
6 SASI_Hs01_00130697 predicted 915
7 SASI_Hs01_00130698 predicted 1823
8 SASI_Hs01_00130699 predicted 2142
9 SASI_Hs01_00130700 predicted 834
10 SASI_Hs02_00356744 predicted 823
11 SASI_Hs01_00130691 predicted 1963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079370 predicted 2121
2 SASI_Hs01_00079371 predicted 1870
3 SASI_Hs01_00079372 predicted 1828
4 SASI_Hs01_00079373 predicted 1924
5 SASI_Hs01_00079374 predicted 2044
6 SASI_Hs01_00079375 predicted 914
7 SASI_Hs01_00079376 predicted 1788
8 SASI_Hs01_00079377 predicted 2097
9 SASI_Hs01_00079378 predicted 841
10 SASI_Hs02_00356745 predicted 816
11 SASI_Hs01_00079369 predicted 1927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117789 predicted 2181
2 SASI_Hs01_00117790 predicted 1923
3 SASI_Hs01_00117791 predicted 1878
4 SASI_Hs01_00117792 predicted 1972
5 SASI_Hs01_00117793 predicted 2094
6 SASI_Hs01_00117794 predicted 913
7 SASI_Hs01_00117795 predicted 1838
8 SASI_Hs01_00117796 predicted 2147
9 SASI_Hs01_00117797 predicted 838
10 SASI_Hs02_00356746 predicted 816
11 SASI_Hs01_00117788 predicted 1978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264685 predicted 1601
2 SASI_Rn01_00086606 predicted 1149
3 SASI_Rn02_00264686 predicted 1393
4 SASI_Rn02_00264687 predicted 1499
5 SASI_Rn01_00086610 predicted 728
6 SASI_Rn02_00264688 predicted 1071
7 SASI_Rn02_00264689 predicted 447
8 SASI_Rn02_00264690 predicted 1629
9 SASI_Rn02_00264691 predicted 1337
10 SASI_Rn02_00264692 predicted 1558
11 SASI_Rn01_00086605 predicted 811
12 SASI_Rn01_00086607 predicted 740
13 SASI_Rn01_00086608 predicted 958
14 SASI_Rn01_00086609 predicted 1283
15 SASI_Rn01_00086611 predicted 1298
16 SASI_Rn01_00086612 predicted 1142
17 SASI_Rn01_00086613 predicted 969
18 SASI_Rn01_00086614 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101396 predicted 1761
2 SASI_Mm01_00101398 predicted 1132
3 SASI_Mm01_00101399 predicted 908
4 SASI_Mm01_00101400 predicted 1310
5 SASI_Mm02_00340120 predicted 1136
6 SASI_Mm01_00101401 predicted 1199
7 SASI_Mm01_00101402 predicted 1176
8 SASI_Mm01_00101403 predicted 1743
9 SASI_Mm01_00101405 predicted 1181
10 SASI_Mm02_00340121 predicted 1533
11 SASI_Mm01_00101397 predicted 1619
12 SASI_Mm01_00101404 predicted 1860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024426
VALIDATED
WT1 MISSION shRNA Bacterial Glycerol Stock
Wilms tumor 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024426.3-2159s21c1
Sequence:CCGGGTGTCTGCTAATGTAAACTTTCTCGAGAAAGTTTACATTAGCAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024426.3-1711s21c1
Sequence:CCGGGCATCAGAGAAACATGACCAACTCGAGTTGGTCATGTTTCTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024426.3-1972s21c1
Sequence:CCGGGCAGCTAACAATGTCTGGTTACTCGAGTAACCAGACATTGTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024426.3-2919s21c1
Sequence:CCGGTATAAGTACTAGATGCATCACCTCGAGGTGATGCATCTAGTACTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024426.3-1340s21c1
Sequence:CCGGGCATCTGAGACCAGTGAGAAACTCGAGTTTCTCACTGGTCTCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024426.2-1055s1c1
Sequence:CCGGGCAGTGACAATTTATACCAAACTCGAGTTTGGTATAAATTGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024426.2-1962s1c1
Sequence:CCGGGCAGCTAACAATGTCTGGTTACTCGAGTAACCAGACATTGTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024426.2-1330s1c1
Sequence:CCGGGCATCTGAGACCAGTGAGAAACTCGAGTTTCTCACTGGTCTCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024426.2-1372s1c1
Sequence:CCGGCCAGGCTGCAATAAGAGATATCTCGAGATATCTCTTATTGCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024426.x-2903s1c1
Sequence:CCGGTATAAGTACTAGATGCATCACCTCGAGGTGATGCATCTAGTACTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024426.x-910s1c1
Sequence:CCGGCACTCATTCAAGCATGAGGATCTCGAGATCCTCATGCTTGAATGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024426.x-1110s1c1
Sequence:CCGGATGAACTTAGGAGCCACCTTCTCGAGAAGGTGGCTCCTAAGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024426
VALIDATED
WT1 MISSION shRNA shRNA Plasmid DNA
Wilms tumor 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024426.3-2159s21c1
Sequence:CCGGGTGTCTGCTAATGTAAACTTTCTCGAGAAAGTTTACATTAGCAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024426.3-1711s21c1
Sequence:CCGGGCATCAGAGAAACATGACCAACTCGAGTTGGTCATGTTTCTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024426.3-1972s21c1
Sequence:CCGGGCAGCTAACAATGTCTGGTTACTCGAGTAACCAGACATTGTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024426.3-2919s21c1
Sequence:CCGGTATAAGTACTAGATGCATCACCTCGAGGTGATGCATCTAGTACTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024426.3-1340s21c1
Sequence:CCGGGCATCTGAGACCAGTGAGAAACTCGAGTTTCTCACTGGTCTCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024426.2-1055s1c1
Sequence:CCGGGCAGTGACAATTTATACCAAACTCGAGTTTGGTATAAATTGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024426.2-1962s1c1
Sequence:CCGGGCAGCTAACAATGTCTGGTTACTCGAGTAACCAGACATTGTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024426.2-1330s1c1
Sequence:CCGGGCATCTGAGACCAGTGAGAAACTCGAGTTTCTCACTGGTCTCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024426.2-1372s1c1
Sequence:CCGGCCAGGCTGCAATAAGAGATATCTCGAGATATCTCTTATTGCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024426.x-2903s1c1
Sequence:CCGGTATAAGTACTAGATGCATCACCTCGAGGTGATGCATCTAGTACTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024426.x-910s1c1
Sequence:CCGGCACTCATTCAAGCATGAGGATCTCGAGATCCTCATGCTTGAATGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024426.x-1110s1c1
Sequence:CCGGATGAACTTAGGAGCCACCTTCTCGAGAAGGTGGCTCCTAAGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024426
VALIDATED
WT1 MISSION shRNA Lentiviral Transduction Particles
Wilms tumor 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024426.3-2159s21c1
Sequence:CCGGGTGTCTGCTAATGTAAACTTTCTCGAGAAAGTTTACATTAGCAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024426.3-1711s21c1
Sequence:CCGGGCATCAGAGAAACATGACCAACTCGAGTTGGTCATGTTTCTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024426.3-1972s21c1
Sequence:CCGGGCAGCTAACAATGTCTGGTTACTCGAGTAACCAGACATTGTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024426.3-2919s21c1
Sequence:CCGGTATAAGTACTAGATGCATCACCTCGAGGTGATGCATCTAGTACTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024426.3-1340s21c1
Sequence:CCGGGCATCTGAGACCAGTGAGAAACTCGAGTTTCTCACTGGTCTCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024426.2-1055s1c1
Sequence:CCGGGCAGTGACAATTTATACCAAACTCGAGTTTGGTATAAATTGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_024426.2-1962s1c1
Sequence:CCGGGCAGCTAACAATGTCTGGTTACTCGAGTAACCAGACATTGTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024426.2-1330s1c1
Sequence:CCGGGCATCTGAGACCAGTGAGAAACTCGAGTTTCTCACTGGTCTCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024426.2-1372s1c1
Sequence:CCGGCCAGGCTGCAATAAGAGATATCTCGAGATATCTCTTATTGCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024426.x-2903s1c1
Sequence:CCGGTATAAGTACTAGATGCATCACCTCGAGGTGATGCATCTAGTACTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024426.x-910s1c1
Sequence:CCGGCACTCATTCAAGCATGAGGATCTCGAGATCCTCATGCTTGAATGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024426.x-1110s1c1
Sequence:CCGGATGAACTTAGGAGCCACCTTCTCGAGAAGGTGGCTCCTAAGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144783
WT1 MISSION shRNA Bacterial Glycerol Stock
Wilms tumor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1530s1c1
Sequence:CCGGACCATACCAGTGTGACTTCAACTCGAGTTGAAGTCACACTGGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1206s1c1
Sequence:CCGGAGGAGCTACCTTAAAGGGAATCTCGAGATTCCCTTTAAGGTAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1416s1c1
Sequence:CCGGAGCATCTGAAACCAGTGAGAACTCGAGTTCTCACTGGTTTCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-898s1c1
Sequence:CCGGCAGCCTACCATCCGCAACCAACTCGAGTTGGTTGCGGATGGTAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1608s1c1
Sequence:CCGGCACAGGTGTGAAACCATTCCACTCGAGTGGAATGGTTTCACACCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1460s1c1
Sequence:CCGGCAGGCTGCAATAAGAGATATTCTCGAGAATATCTCTTATTGCAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1136s1c1
Sequence:CCGGCCTACAGCAGTGACAATTTATCTCGAGATAAATTGTCACTGCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-681s1c1
Sequence:CCGGCCACTCCTTCATCAAACAGGACTCGAGTCCTGTTTGATGAAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1759s1c1
Sequence:CCGGTCAGACGAATTGGTCCGCCATCTCGAGATGGCGGACCAATTCGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1329s1c1
Sequence:CCGGCCAGTACAGAATACACACCCACTCGAGTGGGTGTGTATTCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144783
WT1 MISSION shRNA shRNA Plasmid DNA
Wilms tumor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1530s1c1
Sequence:CCGGACCATACCAGTGTGACTTCAACTCGAGTTGAAGTCACACTGGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1206s1c1
Sequence:CCGGAGGAGCTACCTTAAAGGGAATCTCGAGATTCCCTTTAAGGTAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1416s1c1
Sequence:CCGGAGCATCTGAAACCAGTGAGAACTCGAGTTCTCACTGGTTTCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-898s1c1
Sequence:CCGGCAGCCTACCATCCGCAACCAACTCGAGTTGGTTGCGGATGGTAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1608s1c1
Sequence:CCGGCACAGGTGTGAAACCATTCCACTCGAGTGGAATGGTTTCACACCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1460s1c1
Sequence:CCGGCAGGCTGCAATAAGAGATATTCTCGAGAATATCTCTTATTGCAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1136s1c1
Sequence:CCGGCCTACAGCAGTGACAATTTATCTCGAGATAAATTGTCACTGCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-681s1c1
Sequence:CCGGCCACTCCTTCATCAAACAGGACTCGAGTCCTGTTTGATGAAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1759s1c1
Sequence:CCGGTCAGACGAATTGGTCCGCCATCTCGAGATGGCGGACCAATTCGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1329s1c1
Sequence:CCGGCCAGTACAGAATACACACCCACTCGAGTGGGTGTGTATTCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144783
WT1 MISSION shRNA Lentiviral Transduction Particles
Wilms tumor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1530s1c1
Sequence:CCGGACCATACCAGTGTGACTTCAACTCGAGTTGAAGTCACACTGGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1206s1c1
Sequence:CCGGAGGAGCTACCTTAAAGGGAATCTCGAGATTCCCTTTAAGGTAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1416s1c1
Sequence:CCGGAGCATCTGAAACCAGTGAGAACTCGAGTTCTCACTGGTTTCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-898s1c1
Sequence:CCGGCAGCCTACCATCCGCAACCAACTCGAGTTGGTTGCGGATGGTAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1608s1c1
Sequence:CCGGCACAGGTGTGAAACCATTCCACTCGAGTGGAATGGTTTCACACCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1460s1c1
Sequence:CCGGCAGGCTGCAATAAGAGATATTCTCGAGAATATCTCTTATTGCAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1136s1c1
Sequence:CCGGCCTACAGCAGTGACAATTTATCTCGAGATAAATTGTCACTGCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-681s1c1
Sequence:CCGGCCACTCCTTCATCAAACAGGACTCGAGTCCTGTTTGATGAAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1759s1c1
Sequence:CCGGTCAGACGAATTGGTCCGCCATCTCGAGATGGCGGACCAATTCGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144783.1-1329s1c1
Sequence:CCGGCCAGTACAGAATACACACCCACTCGAGTGGGTGTGTATTCTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024424
VALIDATED
WT1 MISSION shRNA Bacterial Glycerol Stock
Wilms tumor 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024424.x-1047s1c1
Sequence:CCGGGCCCTACAGCAGTGACAATTTCTCGAGAAATTGTCACTGCTGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024424.x-1440s1c1
Sequence:CCGGGAAACCATACCAGTGTGACTTCTCGAGAAGTCACACTGGTATGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_024424.x-588s1c1
Sequence:CCGGGCCGCCTCACTCCTTCATCAACTCGAGTTGATGAAGGAGTGAGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024424.x-904s1c1
Sequence:CCGGCCCAACCACTCATTCAAGCATCTCGAGATGCTTGAATGAGTGGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024424.x-2140s1c1
Sequence:CCGGGTGTCTGCTAATGTAAACTTTCTCGAGAAAGTTTACATTAGCAGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024424
VALIDATED
WT1 MISSION shRNA shRNA Plasmid DNA
Wilms tumor 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024424.x-1047s1c1
Sequence:CCGGGCCCTACAGCAGTGACAATTTCTCGAGAAATTGTCACTGCTGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024424.x-1440s1c1
Sequence:CCGGGAAACCATACCAGTGTGACTTCTCGAGAAGTCACACTGGTATGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_024424.x-588s1c1
Sequence:CCGGGCCGCCTCACTCCTTCATCAACTCGAGTTGATGAAGGAGTGAGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024424.x-904s1c1
Sequence:CCGGCCCAACCACTCATTCAAGCATCTCGAGATGCTTGAATGAGTGGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024424.x-2140s1c1
Sequence:CCGGGTGTCTGCTAATGTAAACTTTCTCGAGAAAGTTTACATTAGCAGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024424
VALIDATED
WT1 MISSION shRNA Lentiviral Transduction Particles
Wilms tumor 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024424.x-1047s1c1
Sequence:CCGGGCCCTACAGCAGTGACAATTTCTCGAGAAATTGTCACTGCTGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024424.x-1440s1c1
Sequence:CCGGGAAACCATACCAGTGTGACTTCTCGAGAAGTCACACTGGTATGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_024424.x-588s1c1
Sequence:CCGGGCCGCCTCACTCCTTCATCAACTCGAGTTGATGAAGGAGTGAGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024424.x-904s1c1
Sequence:CCGGCCCAACCACTCATTCAAGCATCTCGAGATGCTTGAATGAGTGGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024424.x-2140s1c1
Sequence:CCGGGTGTCTGCTAATGTAAACTTTCTCGAGAAAGTTTACATTAGCAGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks