EMAIL THIS PAGE TO A FRIEND

WTAP

Wilms tumor 1 associated protein

UniProtKB ID: Q15007, Q5TCL8, Q5TCL9, Q96T28, Q9BYJ7, Q9H4E2
Gene ID:
Human(9589) Summary: The Wilms tumor suppressor gene WT1 appears to play a role in both transcriptional and posttranscriptional regulation of certain cellular genes. This gene encodes a WT1-associating protein, which is a ubiquitously expressed nuclear protein. Like WT1 protein, this protein is localized throughout the nucleoplasm as well as in speckles and partially colocalizes with splicing factors. Alternative splicing of this gene results in several transcript variants encoding three different isoforms. [provided by RefSeq, Jul 2012]
Mouse(60532) Wilms' tumour 1-associating protein
Rat(499020) Wilms tumor 1 associated protein
cow(532996) Wilms tumor 1 associated protein
domestic guinea pig(100714655) Wilms tumor 1 associated protein
naked mole-rat(101713336) Wilms tumor 1 associated protein
Domestic Rabbit(100339992) Wilms tumor 1 associated protein
Zebrafish(334058) Wilms tumor 1 associated protein
domestic cat(101093020) Wilms tumor 1 associated protein
Horse(100050768) Wilms tumor 1 associated protein
dog(476259) Wilms tumor 1 associated protein
chicken(421588) Wilms tumor 1 associated protein
264 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004906 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004906 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004906 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115481 MISSION® esiRNA esiRNA human WTAP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004906 Rosetta Predictions human pricing
NM_152857 Rosetta Predictions human pricing
NM_152858 Rosetta Predictions human pricing
NM_001113542 Rosetta Predictions rat pricing
NM_001113543 Rosetta Predictions rat pricing
NM_001113544 Rosetta Predictions rat pricing
NM_001113532 Rosetta Predictions mouse pricing
NM_001113533 Rosetta Predictions mouse pricing
NM_175394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039282 predicted 404
2 SASI_Hs01_00039283 predicted 277
3 SASI_Hs01_00039284 predicted 344
4 SASI_Hs01_00039285 predicted 259
5 SASI_Hs01_00039286 predicted 288
6 SASI_Hs01_00039289 predicted 353
7 SASI_Hs01_00039290 predicted 272
8 SASI_Hs02_00338557 predicted 375
9 SASI_Hs02_00338558 predicted 240
10 SASI_Hs02_00338559 predicted 344
11 SASI_Hs01_00039281 predicted 275
12 SASI_Hs01_00039287 predicted 286
13 SASI_Hs01_00039288 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102837 predicted 1059
2 SASI_Hs01_00102838 predicted 907
3 SASI_Hs01_00102839 predicted 378
4 SASI_Hs01_00102840 predicted 371
5 SASI_Hs01_00102841 predicted 1020
6 SASI_Hs01_00102842 predicted 553
7 SASI_Hs01_00102844 predicted 308
8 SASI_Hs01_00102845 predicted 242
9 SASI_Hs01_00102846 predicted 160
10 SASI_Hs02_00366803 predicted 195
11 SASI_Hs01_00102843 predicted 175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235476 predicted 1149
2 SASI_Hs01_00235477 predicted 1010
3 SASI_Hs01_00235478 predicted 475
4 SASI_Hs01_00235479 predicted 470
5 SASI_Hs01_00235480 predicted 1112
6 SASI_Hs01_00235481 predicted 655
7 SASI_Hs01_00235483 predicted 407
8 SASI_Hs01_00235484 predicted 337
9 SASI_Hs01_00235485 predicted 263
10 SASI_Hs02_00366804 predicted 289
11 SASI_Hs01_00235482 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251873 predicted 311
2 SASI_Rn02_00251874 predicted 342
3 SASI_Rn02_00251875 predicted 222
4 SASI_Rn02_00251876 predicted 229
5 SASI_Rn02_00251877 predicted 350
6 SASI_Rn02_00251878 predicted 219
7 SASI_Rn02_00251879 predicted 307
8 SASI_Rn02_00251880 predicted 234
9 SASI_Rn02_00251881 predicted 299
10 SASI_Rn02_00251882 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251883 predicted 1008
2 SASI_Rn02_00251884 predicted 492
3 SASI_Rn02_00251885 predicted 1140
4 SASI_Rn02_00251886 predicted 979
5 SASI_Rn02_00251887 predicted 626
6 SASI_Rn02_00251888 predicted 916
7 SASI_Rn02_00251889 predicted 1132
8 SASI_Rn02_00251890 predicted 917
9 SASI_Rn02_00251891 predicted 1114
10 SASI_Rn02_00251892 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113544 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251893 predicted 937
2 SASI_Rn02_00251894 predicted 433
3 SASI_Rn02_00251895 predicted 1079
4 SASI_Rn02_00251896 predicted 911
5 SASI_Rn02_00251897 predicted 557
6 SASI_Rn02_00251898 predicted 845
7 SASI_Rn02_00251899 predicted 1067
8 SASI_Rn02_00251900 predicted 853
9 SASI_Rn02_00251901 predicted 1047
10 SASI_Rn02_00251902 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113532 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308093 predicted 911
2 SASI_Mm02_00308094 predicted 767
3 SASI_Mm02_00308095 predicted 795
4 SASI_Mm02_00308096 predicted 1140
5 SASI_Mm02_00308097 predicted 972
6 SASI_Mm02_00308098 predicted 1126
7 SASI_Mm02_00308099 predicted 622
8 SASI_Mm02_00308100 predicted 912
9 SASI_Mm02_00308101 predicted 1018
10 SASI_Mm02_00308102 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308103 predicted 388
2 SASI_Mm02_00308104 predicted 403
3 SASI_Mm02_00308105 predicted 386
4 SASI_Mm02_00308106 predicted 411
5 SASI_Mm02_00308107 predicted 415
6 SASI_Mm02_00308108 predicted 391
7 SASI_Mm02_00308109 predicted 394
8 SASI_Mm02_00308110 predicted 386
9 SASI_Mm02_00308111 predicted 382
10 SASI_Mm02_00308112 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346239 predicted 961
2 SASI_Mm02_00346240 predicted 816
3 SASI_Mm01_00193851 predicted 850
4 SASI_Mm02_00346241 predicted 1188
5 SASI_Mm02_00346242 predicted 1018
6 SASI_Mm02_00346243 predicted 1173
7 SASI_Mm01_00193854 predicted 676
8 SASI_Mm02_00346244 predicted 961
9 SASI_Mm02_00346245 predicted 1059
10 SASI_Mm02_00346246 predicted 827
11 SASI_Mm01_00193850 predicted 388
12 SASI_Mm01_00193852 predicted 284
13 SASI_Mm01_00193853 predicted 289
14 SASI_Mm01_00193855 predicted 251
15 SASI_Mm01_00193856 predicted 379
16 SASI_Mm01_00193857 predicted 376
17 SASI_Mm01_00193858 predicted 373
18 SASI_Mm01_00193859 predicted 321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004906
VALIDATED
WTAP MISSION shRNA Bacterial Glycerol Stock
Wilms tumor 1 associated protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004906.x-1593s1c1
Sequence:CCGGGCTTCAATACTTCTGCCGCTTCTCGAGAAGCGGCAGAAGTATTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004906.x-1315s1c1
Sequence:CCGGGAGAAAGCAGTGAGTGGGAAACTCGAGTTTCCCACTCACTGCTTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004906.x-705s1c1
Sequence:CCGGTCGAATGCTTATCCAGGAGAACTCGAGTTCTCCTGGATAAGCATTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004906.x-280s1c1
Sequence:CCGGGTTATGGCAAGAGATGAGTTACTCGAGTAACTCATCTCTTGCCATAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004906.x-1264s1c1
Sequence:CCGGTCTCTCACACACCAATCAAATCTCGAGATTTGATTGGTGTGTGAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004906.3-1660s21c1
Sequence:CCGGTTTGTGTAGGGTCAAGTTATTCTCGAGAATAACTTGACCCTACACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004906.3-1192s21c1
Sequence:CCGGGGAGGTAGTGGTTACGTAAATCTCGAGATTTACGTAACCACTACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004906.3-483s21c1
Sequence:CCGGGCAAGAGTGTACTACTCAAATCTCGAGATTTGAGTAGTACACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004906.3-346s21c1
Sequence:CCGGGGCAAGTACACAGATCTTAACCTCGAGGTTAAGATCTGTGTACTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004906.3-283s21c1
Sequence:CCGGATGGCAAGAGATGAGTTAATTCTCGAGAATTAACTCATCTCTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004906
VALIDATED
WTAP MISSION shRNA shRNA Plasmid DNA
Wilms tumor 1 associated protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004906.x-1593s1c1
Sequence:CCGGGCTTCAATACTTCTGCCGCTTCTCGAGAAGCGGCAGAAGTATTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004906.x-1315s1c1
Sequence:CCGGGAGAAAGCAGTGAGTGGGAAACTCGAGTTTCCCACTCACTGCTTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004906.x-705s1c1
Sequence:CCGGTCGAATGCTTATCCAGGAGAACTCGAGTTCTCCTGGATAAGCATTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004906.x-280s1c1
Sequence:CCGGGTTATGGCAAGAGATGAGTTACTCGAGTAACTCATCTCTTGCCATAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004906.x-1264s1c1
Sequence:CCGGTCTCTCACACACCAATCAAATCTCGAGATTTGATTGGTGTGTGAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004906.3-1660s21c1
Sequence:CCGGTTTGTGTAGGGTCAAGTTATTCTCGAGAATAACTTGACCCTACACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004906.3-1192s21c1
Sequence:CCGGGGAGGTAGTGGTTACGTAAATCTCGAGATTTACGTAACCACTACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004906.3-483s21c1
Sequence:CCGGGCAAGAGTGTACTACTCAAATCTCGAGATTTGAGTAGTACACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004906.3-346s21c1
Sequence:CCGGGGCAAGTACACAGATCTTAACCTCGAGGTTAAGATCTGTGTACTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004906.3-283s21c1
Sequence:CCGGATGGCAAGAGATGAGTTAATTCTCGAGAATTAACTCATCTCTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004906
VALIDATED
WTAP MISSION shRNA Lentiviral Transduction Particles
Wilms tumor 1 associated protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004906.x-1593s1c1
Sequence:CCGGGCTTCAATACTTCTGCCGCTTCTCGAGAAGCGGCAGAAGTATTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004906.x-1315s1c1
Sequence:CCGGGAGAAAGCAGTGAGTGGGAAACTCGAGTTTCCCACTCACTGCTTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004906.x-705s1c1
Sequence:CCGGTCGAATGCTTATCCAGGAGAACTCGAGTTCTCCTGGATAAGCATTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004906.x-280s1c1
Sequence:CCGGGTTATGGCAAGAGATGAGTTACTCGAGTAACTCATCTCTTGCCATAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004906.x-1264s1c1
Sequence:CCGGTCTCTCACACACCAATCAAATCTCGAGATTTGATTGGTGTGTGAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004906.3-1660s21c1
Sequence:CCGGTTTGTGTAGGGTCAAGTTATTCTCGAGAATAACTTGACCCTACACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004906.3-1192s21c1
Sequence:CCGGGGAGGTAGTGGTTACGTAAATCTCGAGATTTACGTAACCACTACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004906.3-483s21c1
Sequence:CCGGGCAAGAGTGTACTACTCAAATCTCGAGATTTGAGTAGTACACTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004906.3-346s21c1
Sequence:CCGGGGCAAGTACACAGATCTTAACCTCGAGGTTAAGATCTGTGTACTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004906.3-283s21c1
Sequence:CCGGATGGCAAGAGATGAGTTAATTCTCGAGAATTAACTCATCTCTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175394
VALIDATED
WTAP MISSION shRNA Bacterial Glycerol Stock
Wilms tumor 1 associated protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175394.1-2981s1c1
Sequence:CCGGCCCATCAATGAGGTTTCATTACTCGAGTAATGAAACCTCATTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175394.1-279s1c1
Sequence:CCGGCCGACTGAGTGAAACAGACTTCTCGAGAAGTCTGTTTCACTCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175394.1-586s1c1
Sequence:CCGGGACCCAGCAATCAACTTGTTTCTCGAGAAACAAGTTGATTGCTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175394.1-310s1c1
Sequence:CCGGGCACGGGATGAGTTAATTCTACTCGAGTAGAATTAACTCATCCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175394.1-677s1c1
Sequence:CCGGCCTGGAAGTTTACGCCTGATACTCGAGTATCAGGCGTAAACTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175394.2-363s21c1
Sequence:CCGGGGAAAGTACACAGATCTTAATCTCGAGATTAAGATCTGTGTACTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175394.2-303s21c1
Sequence:CCGGGCACGGGATGAGTTAATTCTACTCGAGTAGAATTAACTCATCCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175394.2-826s21c1
Sequence:CCGGGTCCAGCTTGTAATGGTTAATCTCGAGATTAACCATTACAAGCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175394.2-615s21c1
Sequence:CCGGGGTGAACTGGAACAGACTAAACTCGAGTTTAGTCTGTTCCAGTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175394
VALIDATED
WTAP MISSION shRNA shRNA Plasmid DNA
Wilms tumor 1 associated protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175394.1-2981s1c1
Sequence:CCGGCCCATCAATGAGGTTTCATTACTCGAGTAATGAAACCTCATTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175394.1-279s1c1
Sequence:CCGGCCGACTGAGTGAAACAGACTTCTCGAGAAGTCTGTTTCACTCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175394.1-586s1c1
Sequence:CCGGGACCCAGCAATCAACTTGTTTCTCGAGAAACAAGTTGATTGCTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175394.1-310s1c1
Sequence:CCGGGCACGGGATGAGTTAATTCTACTCGAGTAGAATTAACTCATCCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175394.1-677s1c1
Sequence:CCGGCCTGGAAGTTTACGCCTGATACTCGAGTATCAGGCGTAAACTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175394.2-363s21c1
Sequence:CCGGGGAAAGTACACAGATCTTAATCTCGAGATTAAGATCTGTGTACTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175394.2-303s21c1
Sequence:CCGGGCACGGGATGAGTTAATTCTACTCGAGTAGAATTAACTCATCCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175394.2-826s21c1
Sequence:CCGGGTCCAGCTTGTAATGGTTAATCTCGAGATTAACCATTACAAGCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175394.2-615s21c1
Sequence:CCGGGGTGAACTGGAACAGACTAAACTCGAGTTTAGTCTGTTCCAGTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175394
VALIDATED
WTAP MISSION shRNA Lentiviral Transduction Particles
Wilms tumor 1 associated protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175394.1-2981s1c1
Sequence:CCGGCCCATCAATGAGGTTTCATTACTCGAGTAATGAAACCTCATTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175394.1-279s1c1
Sequence:CCGGCCGACTGAGTGAAACAGACTTCTCGAGAAGTCTGTTTCACTCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175394.1-586s1c1
Sequence:CCGGGACCCAGCAATCAACTTGTTTCTCGAGAAACAAGTTGATTGCTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175394.1-310s1c1
Sequence:CCGGGCACGGGATGAGTTAATTCTACTCGAGTAGAATTAACTCATCCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175394.1-677s1c1
Sequence:CCGGCCTGGAAGTTTACGCCTGATACTCGAGTATCAGGCGTAAACTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175394.2-363s21c1
Sequence:CCGGGGAAAGTACACAGATCTTAATCTCGAGATTAAGATCTGTGTACTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175394.2-303s21c1
Sequence:CCGGGCACGGGATGAGTTAATTCTACTCGAGTAGAATTAACTCATCCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175394.2-826s21c1
Sequence:CCGGGTCCAGCTTGTAATGGTTAATCTCGAGATTAACCATTACAAGCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175394.2-615s21c1
Sequence:CCGGGGTGAACTGGAACAGACTAAACTCGAGTTTAGTCTGTTCCAGTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks