EMAIL THIS PAGE TO A FRIEND

WTH3DI

Species: Human WTH3DI(150786)
Gene ID:
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412928 Anti-LOC150786 antibody produced in mouse purified immunoglobulin, 1 mg/mL human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001077637 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077637 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077637 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077637 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313044 predicted 990
2 SASI_Hs02_00313045 predicted 1071
3 SASI_Hs02_00313046 predicted 1265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077637
WTH3DI MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077637.1-1189s21c1
Sequence:CCGGGTCTCGTGGAGATGATCTATTCTCGAGAATAGATCATCTCCACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077637.1-702s21c1
Sequence:CCGGAGCTGTAGTAGTTTACGATATCTCGAGATATCGTAAACTACTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077637.1-3420s21c1
Sequence:CCGGTTTCCCTGATTACCAATATTACTCGAGTAATATTGGTAATCAGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077637.1-555s21c1
Sequence:CCGGCAACACCTATCAGGCAATAATCTCGAGATTATTGCCTGATAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077637.1-877s21c1
Sequence:CCGGGGGCTGAATGTTACGTTTATTCTCGAGAATAAACGTAACATTCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077637
WTH3DI MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077637.1-1189s21c1
Sequence:CCGGGTCTCGTGGAGATGATCTATTCTCGAGAATAGATCATCTCCACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077637.1-702s21c1
Sequence:CCGGAGCTGTAGTAGTTTACGATATCTCGAGATATCGTAAACTACTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077637.1-3420s21c1
Sequence:CCGGTTTCCCTGATTACCAATATTACTCGAGTAATATTGGTAATCAGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077637.1-555s21c1
Sequence:CCGGCAACACCTATCAGGCAATAATCTCGAGATTATTGCCTGATAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077637.1-877s21c1
Sequence:CCGGGGGCTGAATGTTACGTTTATTCTCGAGAATAAACGTAACATTCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077637
WTH3DI MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077637.1-1189s21c1
Sequence:CCGGGTCTCGTGGAGATGATCTATTCTCGAGAATAGATCATCTCCACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077637.1-702s21c1
Sequence:CCGGAGCTGTAGTAGTTTACGATATCTCGAGATATCGTAAACTACTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077637.1-3420s21c1
Sequence:CCGGTTTCCCTGATTACCAATATTACTCGAGTAATATTGGTAATCAGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077637.1-555s21c1
Sequence:CCGGCAACACCTATCAGGCAATAATCTCGAGATTATTGCCTGATAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077637.1-877s21c1
Sequence:CCGGGGGCTGAATGTTACGTTTATTCTCGAGAATAAACGTAACATTCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks