EMAIL THIS PAGE TO A FRIEND

WTIP

Wilms tumor 1 interacting protein

UniProtKB ID: A6NIX2
Gene ID:
Mouse(101543) WT1-interacting protein
Rat(361552) Wilms tumor 1 interacting protein
Zebrafish(566046) Wilms tumor 1 interacting protein
chicken(769595) Wilms tumor 1 interacting protein
domestic cat(101082110) Wilms tumor 1 interacting protein
dog(100683350) Wilms tumor 1 interacting protein
naked mole-rat(101718505) Wilms tumor 1 interacting protein
domestic guinea pig(100732371) Wilms tumor 1 interacting protein
cow(505059) Wilms tumor 1 interacting protein
sheep(101112921) Wilms tumor 1 interacting protein
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080436 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207212 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207212 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207212 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080436 Rosetta Predictions human pricing
XM_059037 Rosetta Predictions human pricing
XM_001079532 Rosetta Predictions rat pricing
XM_341839 Rosetta Predictions rat pricing
NM_207212 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314826 predicted 875
2 SASI_Hs02_00314827 predicted 1262
3 SASI_Hs02_00314828 predicted 1428
4 SASI_Hs02_00314829 predicted 738
5 SASI_Hs02_00314830 predicted 1426
6 SASI_Hs02_00314831 predicted 1436
7 SASI_Hs02_00314832 predicted 803
8 SASI_Hs02_00314833 predicted 790
9 SASI_Hs02_00314834 predicted 844
10 SASI_Hs02_00314835 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_059037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284792 predicted 883
2 SASI_Hs01_00284793 predicted 1266
3 SASI_Hs01_00284794 predicted 1429
4 SASI_Hs01_00284795 predicted 747
5 SASI_Hs01_00284796 predicted 1439
6 SASI_Hs01_00284797 predicted 1444
7 SASI_Hs01_00284798 predicted 805
8 SASI_Hs01_00284799 predicted 794
9 SASI_Hs01_00284800 predicted 843
10 SASI_Hs01_00284801 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364624 predicted 963
2 SASI_Rn02_00364625 predicted 528
3 SASI_Rn02_00364626 predicted 681
4 SASI_Rn02_00364627 predicted 603
5 SASI_Rn02_00364628 predicted 1070
6 SASI_Rn02_00364629 predicted 236
7 SASI_Rn02_00364630 predicted 668
8 SASI_Rn02_00364631 predicted 423
9 SASI_Rn02_00364632 predicted 1071
10 SASI_Rn02_00364633 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341839 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393453 predicted 816
2 SASI_Rn02_00393454 predicted 944
3 SASI_Rn02_00393455 predicted 803
4 SASI_Rn02_00393456 predicted 811
5 SASI_Rn02_00393457 predicted 902
6 SASI_Rn02_00393458 predicted 941
7 SASI_Rn02_00393459 predicted 894
8 SASI_Rn02_00393460 predicted 810
9 SASI_Rn02_00393461 predicted 816
10 SASI_Rn02_00393462 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351934 predicted 1474
2 SASI_Mm01_00084805 predicted 1239
3 SASI_Mm01_00084806 predicted 1200
4 SASI_Mm01_00084807 predicted 1139
5 SASI_Mm01_00084808 predicted 901
6 SASI_Mm01_00084809 predicted 1558
7 SASI_Mm01_00084810 predicted 468
8 SASI_Mm01_00084811 predicted 763
9 SASI_Mm01_00084812 predicted 1194
10 SASI_Mm01_00084813 predicted 1625
11 SASI_Mm01_00084814 predicted 1477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080436
WTIP MISSION shRNA Bacterial Glycerol Stock
Wilms tumor 1 interacting protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080436.1-870s21c1
Sequence:CCGGCAGCGTGTGTGGACATCTCATCTCGAGATGAGATGTCCACACACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080436.1-662s21c1
Sequence:CCGGACTTCGGCATTTGCATCAAGTCTCGAGACTTGATGCAAATGCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080436.1-794s21c1
Sequence:CCGGTCTACAACGTGGGTGAGAAAGCTCGAGCTTTCTCACCCACGTTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080436.1-1007s21c1
Sequence:CCGGTCTACTGCGTGCGAGACTATCCTCGAGGATAGTCTCGCACGCAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080436.1-1430s21c1
Sequence:CCGGCCGCGTGGAAGCTTCTATTTACTCGAGTAAATAGAAGCTTCCACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080436
WTIP MISSION shRNA shRNA Plasmid DNA
Wilms tumor 1 interacting protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080436.1-870s21c1
Sequence:CCGGCAGCGTGTGTGGACATCTCATCTCGAGATGAGATGTCCACACACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080436.1-662s21c1
Sequence:CCGGACTTCGGCATTTGCATCAAGTCTCGAGACTTGATGCAAATGCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080436.1-794s21c1
Sequence:CCGGTCTACAACGTGGGTGAGAAAGCTCGAGCTTTCTCACCCACGTTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080436.1-1007s21c1
Sequence:CCGGTCTACTGCGTGCGAGACTATCCTCGAGGATAGTCTCGCACGCAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080436.1-1430s21c1
Sequence:CCGGCCGCGTGGAAGCTTCTATTTACTCGAGTAAATAGAAGCTTCCACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080436
WTIP MISSION shRNA Lentiviral Transduction Particles
Wilms tumor 1 interacting protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080436.1-870s21c1
Sequence:CCGGCAGCGTGTGTGGACATCTCATCTCGAGATGAGATGTCCACACACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080436.1-662s21c1
Sequence:CCGGACTTCGGCATTTGCATCAAGTCTCGAGACTTGATGCAAATGCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080436.1-794s21c1
Sequence:CCGGTCTACAACGTGGGTGAGAAAGCTCGAGCTTTCTCACCCACGTTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080436.1-1007s21c1
Sequence:CCGGTCTACTGCGTGCGAGACTATCCTCGAGGATAGTCTCGCACGCAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239376    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080436.1-1430s21c1
Sequence:CCGGCCGCGTGGAAGCTTCTATTTACTCGAGTAAATAGAAGCTTCCACGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207212
WTIP MISSION shRNA Bacterial Glycerol Stock
Wilms tumor 1 interacting protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207212.1-1471s1c1
Sequence:CCGGCCCGCAACAAAGAAGCGATTTCTCGAGAAATCGCTTCTTTGTTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207212.1-766s1c1
Sequence:CCGGCGCGAGACTACTTTGGCATTTCTCGAGAAATGCCAAAGTAGTCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207212.1-768s1c1
Sequence:CCGGCGAGACTACTTTGGCATTTGTCTCGAGACAAATGCCAAAGTAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207212.1-1131s1c1
Sequence:CCGGAGAGACTATCATACGGTGTTTCTCGAGAAACACCGTATGATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207212.1-1111s1c1
Sequence:CCGGACAACAACATTTACTGCGTTACTCGAGTAACGCAGTAAATGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207212
WTIP MISSION shRNA shRNA Plasmid DNA
Wilms tumor 1 interacting protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207212.1-1471s1c1
Sequence:CCGGCCCGCAACAAAGAAGCGATTTCTCGAGAAATCGCTTCTTTGTTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207212.1-766s1c1
Sequence:CCGGCGCGAGACTACTTTGGCATTTCTCGAGAAATGCCAAAGTAGTCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207212.1-768s1c1
Sequence:CCGGCGAGACTACTTTGGCATTTGTCTCGAGACAAATGCCAAAGTAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207212.1-1131s1c1
Sequence:CCGGAGAGACTATCATACGGTGTTTCTCGAGAAACACCGTATGATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207212.1-1111s1c1
Sequence:CCGGACAACAACATTTACTGCGTTACTCGAGTAACGCAGTAAATGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207212
WTIP MISSION shRNA Lentiviral Transduction Particles
Wilms tumor 1 interacting protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207212.1-1471s1c1
Sequence:CCGGCCCGCAACAAAGAAGCGATTTCTCGAGAAATCGCTTCTTTGTTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207212.1-766s1c1
Sequence:CCGGCGCGAGACTACTTTGGCATTTCTCGAGAAATGCCAAAGTAGTCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207212.1-768s1c1
Sequence:CCGGCGAGACTACTTTGGCATTTGTCTCGAGACAAATGCCAAAGTAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207212.1-1131s1c1
Sequence:CCGGAGAGACTATCATACGGTGTTTCTCGAGAAACACCGTATGATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207212.1-1111s1c1
Sequence:CCGGACAACAACATTTACTGCGTTACTCGAGTAACGCAGTAAATGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks