EMAIL THIS PAGE TO A FRIEND

WWC1

WW and C2 domain containing 1

Synonyms: HBEBP3 HBEBP36 KIBRA
Gene ID:
Human(23286) Summary: The protein encoded by this gene is a cytoplasmic phosphoprotein that interacts with PRKC-zeta and dynein light chain-1. Alleles of this gene have been found that enhance memory in some individuals. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(211652) WW, C2 and coiled-coil domain containing 1
Rat(303039) WW and C2 domain containing 1
sheep(101117418) WW and C2 domain containing 1
Domestic Rabbit(100358939) WW and C2 domain containing 1
naked mole-rat(101712895) WW and C2 domain containing 1
domestic guinea pig(100712753) WW and C2 domain containing 1
chicken(416167) WW and C2 domain containing 1
dog(479297) WW and C2 domain containing 1
domestic cat(101092738) WW and C2 domain containing 1
Horse(100070535) WW and C2 domain containing 1
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015238 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015238 Rosetta Predictions human pricing
XM_001066364 Rosetta Predictions rat pricing
XM_220308 Rosetta Predictions rat pricing
NM_170779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135409 predicted 867
2 SASI_Hs01_00135410 predicted 939
3 SASI_Hs01_00135412 predicted 2084
4 SASI_Hs01_00135413 predicted 1247
5 SASI_Hs01_00135414 predicted 240
6 SASI_Hs01_00135415 predicted 967
7 SASI_Hs01_00135416 predicted 2171
8 SASI_Hs01_00135417 predicted 2006
9 SASI_Hs01_00135418 predicted 2001
10 SASI_Hs02_00347370 predicted 2047
11 SASI_Hs01_00135411 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066364 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317243 predicted 1164
2 SASI_Rn02_00317244 predicted 2109
3 SASI_Rn02_00317245 predicted 291
4 SASI_Rn02_00317246 predicted 570
5 SASI_Rn02_00317247 predicted 2089
6 SASI_Rn02_00317248 predicted 575
7 SASI_Rn02_00317249 predicted 2887
8 SASI_Rn02_00317250 predicted 905
9 SASI_Rn02_00317251 predicted 746
10 SASI_Rn02_00317252 predicted 2195
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379205 predicted 1162
2 SASI_Rn02_00379206 predicted 2107
3 SASI_Rn02_00379207 predicted 295
4 SASI_Rn02_00379208 predicted 569
5 SASI_Rn02_00379209 predicted 2085
6 SASI_Rn02_00379210 predicted 572
7 SASI_Rn02_00379211 predicted 2886
8 SASI_Rn02_00379212 predicted 905
9 SASI_Rn02_00379213 predicted 740
10 SASI_Rn02_00379214 predicted 2196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083225 predicted 894
2 SASI_Mm01_00083227 predicted 2774
3 SASI_Mm01_00083228 predicted 484
4 SASI_Mm01_00083229 predicted 201
5 SASI_Mm01_00083230 predicted 491
6 SASI_Mm01_00083231 predicted 879
7 SASI_Mm01_00083232 predicted 709
8 SASI_Mm01_00083233 predicted 651
9 SASI_Mm01_00083234 predicted 2160
10 SASI_Mm02_00343632 predicted 2118
11 SASI_Mm01_00083226 predicted 2625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170779
VALIDATED
WWC1 MISSION shRNA Bacterial Glycerol Stock
WW and C2 domain containing 1
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170779.1-711s1c1
Sequence:CCGGCCTCATTAAGAGTCTCGCCATCTCGAGATGGCGAGACTCTTAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170779.1-376s1c1
Sequence:CCGGCAGGAGTATCAGCAGTTGCATCTCGAGATGCAACTGCTGATACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170779.1-2623s1c1
Sequence:CCGGCCAGCATTAAAGGTGGACAGACTCGAGTCTGTCCACCTTTAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170779.1-2172s1c1
Sequence:CCGGCCTCGTGTTCAATGAGGCATTCTCGAGAATGCCTCATTGAACACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170779.1-529s1c1
Sequence:CCGGGAGATGGTTCACCTACAGCATCTCGAGATGCTGTAGGTGAACCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170779.1-2807s1c1
Sequence:CCGGGCAGTGACAGTGATAGTTCTACTCGAGTAGAACTATCACTGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170779.1-472s1c1
Sequence:CCGGGAGATCCTGAAAGCTGAAATTCTCGAGAATTTCAGCTTTCAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170779.1-205s1c1
Sequence:CCGGGATTACTTCATAGACCACAATCTCGAGATTGTGGTCTATGAAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170779.1-1188s1c1
Sequence:CCGGGAAGTTAAATAGCAAGAGGAACTCGAGTTCCTCTTGCTATTTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170779.1-2083s1c1
Sequence:CCGGCAGAAAGTGAACATCCGTGTACTCGAGTACACGGATGTTCACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170779.1-2083s21c1
Sequence:CCGGCAGAAAGTGAACATCCGTGTACTCGAGTACACGGATGTTCACTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170779.1-1380s21c1
Sequence:CCGGCAGCTTCACTGACCTCTATTACTCGAGTAATAGAGGTCAGTGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170779.1-472s21c1
Sequence:CCGGGAGATCCTGAAAGCTGAAATTCTCGAGAATTTCAGCTTTCAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170779.1-2784s21c1
Sequence:CCGGCCAGTATGTGTGTCGGCTAAACTCGAGTTTAGCCGACACACATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170779.1-205s21c1
Sequence:CCGGGATTACTTCATAGACCACAATCTCGAGATTGTGGTCTATGAAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170779
VALIDATED
WWC1 MISSION shRNA shRNA Plasmid DNA
WW and C2 domain containing 1
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170779.1-711s1c1
Sequence:CCGGCCTCATTAAGAGTCTCGCCATCTCGAGATGGCGAGACTCTTAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170779.1-376s1c1
Sequence:CCGGCAGGAGTATCAGCAGTTGCATCTCGAGATGCAACTGCTGATACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170779.1-2623s1c1
Sequence:CCGGCCAGCATTAAAGGTGGACAGACTCGAGTCTGTCCACCTTTAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170779.1-2172s1c1
Sequence:CCGGCCTCGTGTTCAATGAGGCATTCTCGAGAATGCCTCATTGAACACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170779.1-529s1c1
Sequence:CCGGGAGATGGTTCACCTACAGCATCTCGAGATGCTGTAGGTGAACCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170779.1-2807s1c1
Sequence:CCGGGCAGTGACAGTGATAGTTCTACTCGAGTAGAACTATCACTGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170779.1-472s1c1
Sequence:CCGGGAGATCCTGAAAGCTGAAATTCTCGAGAATTTCAGCTTTCAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170779.1-205s1c1
Sequence:CCGGGATTACTTCATAGACCACAATCTCGAGATTGTGGTCTATGAAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170779.1-1188s1c1
Sequence:CCGGGAAGTTAAATAGCAAGAGGAACTCGAGTTCCTCTTGCTATTTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170779.1-2083s1c1
Sequence:CCGGCAGAAAGTGAACATCCGTGTACTCGAGTACACGGATGTTCACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170779.1-2083s21c1
Sequence:CCGGCAGAAAGTGAACATCCGTGTACTCGAGTACACGGATGTTCACTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170779.1-1380s21c1
Sequence:CCGGCAGCTTCACTGACCTCTATTACTCGAGTAATAGAGGTCAGTGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170779.1-472s21c1
Sequence:CCGGGAGATCCTGAAAGCTGAAATTCTCGAGAATTTCAGCTTTCAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170779.1-2784s21c1
Sequence:CCGGCCAGTATGTGTGTCGGCTAAACTCGAGTTTAGCCGACACACATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170779.1-205s21c1
Sequence:CCGGGATTACTTCATAGACCACAATCTCGAGATTGTGGTCTATGAAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170779
VALIDATED
WWC1 MISSION shRNA Lentiviral Transduction Particles
WW and C2 domain containing 1
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170779.1-711s1c1
Sequence:CCGGCCTCATTAAGAGTCTCGCCATCTCGAGATGGCGAGACTCTTAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170779.1-376s1c1
Sequence:CCGGCAGGAGTATCAGCAGTTGCATCTCGAGATGCAACTGCTGATACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182717    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170779.1-2623s1c1
Sequence:CCGGCCAGCATTAAAGGTGGACAGACTCGAGTCTGTCCACCTTTAATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170779.1-2172s1c1
Sequence:CCGGCCTCGTGTTCAATGAGGCATTCTCGAGAATGCCTCATTGAACACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_170779.1-529s1c1
Sequence:CCGGGAGATGGTTCACCTACAGCATCTCGAGATGCTGTAGGTGAACCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170779.1-2807s1c1
Sequence:CCGGGCAGTGACAGTGATAGTTCTACTCGAGTAGAACTATCACTGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170779.1-472s1c1
Sequence:CCGGGAGATCCTGAAAGCTGAAATTCTCGAGAATTTCAGCTTTCAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170779.1-205s1c1
Sequence:CCGGGATTACTTCATAGACCACAATCTCGAGATTGTGGTCTATGAAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170779.1-1188s1c1
Sequence:CCGGGAAGTTAAATAGCAAGAGGAACTCGAGTTCCTCTTGCTATTTAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170779.1-2083s1c1
Sequence:CCGGCAGAAAGTGAACATCCGTGTACTCGAGTACACGGATGTTCACTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170779.1-2083s21c1
Sequence:CCGGCAGAAAGTGAACATCCGTGTACTCGAGTACACGGATGTTCACTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170779.1-1380s21c1
Sequence:CCGGCAGCTTCACTGACCTCTATTACTCGAGTAATAGAGGTCAGTGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170779.1-472s21c1
Sequence:CCGGGAGATCCTGAAAGCTGAAATTCTCGAGAATTTCAGCTTTCAGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170779.1-2784s21c1
Sequence:CCGGCCAGTATGTGTGTCGGCTAAACTCGAGTTTAGCCGACACACATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170779.1-205s21c1
Sequence:CCGGGATTACTTCATAGACCACAATCTCGAGATTGTGGTCTATGAAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015238
VALIDATED
WWC1 MISSION shRNA Bacterial Glycerol Stock
WW and C2 domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167467    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015238.1-3778s1c1
Sequence:CCGGGAGGTCTTACTGCAATAAGAACTCGAGTTCTTATTGCAGTAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015238.1-121s1c1
Sequence:CCGGGACGGCAAGGTCTACTACATACTCGAGTATGTAGTAGACCTTGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_015238.1-971s21c1
Sequence:CCGGTCAGATTGCGCCTTCGATATGCTCGAGCATATCGAAGGCGCAATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_015238.1-3389s21c1
Sequence:CCGGTCTCTGCAGATGACGTCTAATCTCGAGATTAGACGTCATCTGCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015238.1-2409s21c1
Sequence:CCGGCAACCTTCTCAGCTACAAATACTCGAGTATTTGTAGCTGAGAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015238.1-3841s21c1
Sequence:CCGGTTGTCACAGTACAGCTAATTTCTCGAGAAATTAGCTGTACTGTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_015238.1-2280s21c1
Sequence:CCGGCCTTCACCAGAAGACCTTAAGCTCGAGCTTAAGGTCTTCTGGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015238
VALIDATED
WWC1 MISSION shRNA shRNA Plasmid DNA
WW and C2 domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167467    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015238.1-3778s1c1
Sequence:CCGGGAGGTCTTACTGCAATAAGAACTCGAGTTCTTATTGCAGTAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015238.1-121s1c1
Sequence:CCGGGACGGCAAGGTCTACTACATACTCGAGTATGTAGTAGACCTTGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_015238.1-971s21c1
Sequence:CCGGTCAGATTGCGCCTTCGATATGCTCGAGCATATCGAAGGCGCAATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_015238.1-3389s21c1
Sequence:CCGGTCTCTGCAGATGACGTCTAATCTCGAGATTAGACGTCATCTGCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015238.1-2409s21c1
Sequence:CCGGCAACCTTCTCAGCTACAAATACTCGAGTATTTGTAGCTGAGAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015238.1-3841s21c1
Sequence:CCGGTTGTCACAGTACAGCTAATTTCTCGAGAAATTAGCTGTACTGTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_015238.1-2280s21c1
Sequence:CCGGCCTTCACCAGAAGACCTTAAGCTCGAGCTTAAGGTCTTCTGGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015238
VALIDATED
WWC1 MISSION shRNA Lentiviral Transduction Particles
WW and C2 domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167467    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015238.1-3778s1c1
Sequence:CCGGGAGGTCTTACTGCAATAAGAACTCGAGTTCTTATTGCAGTAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015238.1-121s1c1
Sequence:CCGGGACGGCAAGGTCTACTACATACTCGAGTATGTAGTAGACCTTGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_015238.1-971s21c1
Sequence:CCGGTCAGATTGCGCCTTCGATATGCTCGAGCATATCGAAGGCGCAATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_015238.1-3389s21c1
Sequence:CCGGTCTCTGCAGATGACGTCTAATCTCGAGATTAGACGTCATCTGCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015238.1-2409s21c1
Sequence:CCGGCAACCTTCTCAGCTACAAATACTCGAGTATTTGTAGCTGAGAAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015238.1-3841s21c1
Sequence:CCGGTTGTCACAGTACAGCTAATTTCTCGAGAAATTAGCTGTACTGTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_015238.1-2280s21c1
Sequence:CCGGCCTTCACCAGAAGACCTTAAGCTCGAGCTTAAGGTCTTCTGGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks