EMAIL THIS PAGE TO A FRIEND

WWC2-AS2

WWC2 antisense RNA 2

Synonyms: C4orf38
Species: Human WWC2-AS2(152641)
UniProtKB ID: Q96NR7
Gene ID:
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153008 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153008 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153008 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU228381 MISSION® esiRNA esiRNA targeting human C4orf38 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153008 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103127 predicted 970
2 SASI_Hs01_00103128 predicted 1275
3 SASI_Hs01_00103129 predicted 1583
4 SASI_Hs01_00103130 predicted 1637
5 SASI_Hs01_00103131 predicted 953
6 SASI_Hs01_00103132 predicted 1291
7 SASI_Hs01_00103133 predicted 1618
8 SASI_Hs01_00103134 predicted 1244
9 SASI_Hs01_00103135 predicted 1613
10 SASI_Hs01_00103136 predicted 799
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153008
WWC2-AS2 MISSION shRNA Bacterial Glycerol Stock
WWC2 antisense RNA 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000185513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153008.3-978s1c1
Sequence:CCGGGCATTTATTTATTCAGCAGCTCTCGAGAGCTGCTGAATAAATAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153008.3-1272s1c1
Sequence:CCGGCGTTTAATCCTGCCCGCTAATCTCGAGATTAGCGGGCAGGATTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153008.3-966s1c1
Sequence:CCGGCCTGTTGCATAGGCATTTATTCTCGAGAATAAATGCCTATGCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153008.3-1178s1c1
Sequence:CCGGCGTCATCTTCTTCTGGGTTACCTCGAGGTAACCCAGAAGAAGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153008.3-962s1c1
Sequence:CCGGGTTCCCTGTTGCATAGGCATTCTCGAGAATGCCTATGCAACAGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153008
WWC2-AS2 MISSION shRNA shRNA Plasmid DNA
WWC2 antisense RNA 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000185513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153008.3-978s1c1
Sequence:CCGGGCATTTATTTATTCAGCAGCTCTCGAGAGCTGCTGAATAAATAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153008.3-1272s1c1
Sequence:CCGGCGTTTAATCCTGCCCGCTAATCTCGAGATTAGCGGGCAGGATTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153008.3-966s1c1
Sequence:CCGGCCTGTTGCATAGGCATTTATTCTCGAGAATAAATGCCTATGCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153008.3-1178s1c1
Sequence:CCGGCGTCATCTTCTTCTGGGTTACCTCGAGGTAACCCAGAAGAAGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153008.3-962s1c1
Sequence:CCGGGTTCCCTGTTGCATAGGCATTCTCGAGAATGCCTATGCAACAGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153008
WWC2-AS2 MISSION shRNA Lentiviral Transduction Particles
WWC2 antisense RNA 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000185513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153008.3-978s1c1
Sequence:CCGGGCATTTATTTATTCAGCAGCTCTCGAGAGCTGCTGAATAAATAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153008.3-1272s1c1
Sequence:CCGGCGTTTAATCCTGCCCGCTAATCTCGAGATTAGCGGGCAGGATTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153008.3-966s1c1
Sequence:CCGGCCTGTTGCATAGGCATTTATTCTCGAGAATAAATGCCTATGCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153008.3-1178s1c1
Sequence:CCGGCGTCATCTTCTTCTGGGTTACCTCGAGGTAACCCAGAAGAAGATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153008.3-962s1c1
Sequence:CCGGGTTCCCTGTTGCATAGGCATTCTCGAGAATGCCTATGCAACAGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks