EMAIL THIS PAGE TO A FRIEND

WWC2

WW and C2 domain containing 2

Synonyms: BOMB
Gene ID:
Mouse(52357) WW, C2 and coiled-coil domain containing 2
Rat(498630) WW and C2 domain containing 2
chicken(422555) WW and C2 domain containing 2
domestic cat(101094842) WW and C2 domain containing 2
Horse(100058969) WW and C2 domain containing 2
dog(482920) WW and C2 domain containing 2
domestic guinea pig(100719966) WW and C2 domain containing 2
naked mole-rat(101726043) WW and C2 domain containing 2
cow(532571) WW and C2 domain containing 2
sheep(101107162) WW and C2 domain containing 2
160 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133791 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133791 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133791 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024949 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024949 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024949 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024949 Rosetta Predictions human pricing
NM_001109111 Rosetta Predictions rat pricing
NM_133791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161481 predicted 2196
2 SASI_Hs02_00357603 predicted 603
3 SASI_Hs01_00161483 predicted 2531
4 SASI_Hs01_00161484 predicted 1585
5 SASI_Hs02_00357604 predicted 574
6 SASI_Hs01_00161486 predicted 1073
7 SASI_Hs01_00161488 predicted 2281
8 SASI_Hs01_00161489 predicted 1024
9 SASI_Hs02_00357605 predicted 687
10 SASI_Hs01_00161490 predicted 2312
11 SASI_Hs01_00161482 predicted 1017
12 SASI_Hs01_00161485 predicted 652
13 SASI_Hs01_00161487 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245230 predicted 1179
2 SASI_Rn02_00245231 predicted 1107
3 SASI_Rn02_00245232 predicted 1342
4 SASI_Rn02_00245233 predicted 2896
5 SASI_Rn02_00245234 predicted 3119
6 SASI_Rn02_00245235 predicted 919
7 SASI_Rn02_00245236 predicted 2842
8 SASI_Rn02_00245237 predicted 1954
9 SASI_Rn02_00245238 predicted 3615
10 SASI_Rn02_00245239 predicted 3605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186650 predicted 1098
2 SASI_Mm01_00186651 predicted 855
3 SASI_Mm02_00338816 predicted 3239
4 SASI_Mm01_00186652 predicted 3329
5 SASI_Mm01_00186653 predicted 2481
6 SASI_Mm01_00186654 predicted 553
7 SASI_Mm01_00186655 predicted 3222
8 SASI_Mm01_00186656 predicted 603
9 SASI_Mm01_00186657 predicted 1597
10 SASI_Mm01_00186658 predicted 1604
11 SASI_Mm01_00186659 predicted 1746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133791
VALIDATED
WWC2 MISSION shRNA Bacterial Glycerol Stock
WW and C2 domain containing 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133791.4-4070s21c1
Sequence:CCGGCTTCCGTTTCATACCAGTTTCCTCGAGGAAACTGGTATGAAACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133791.4-2039s21c1
Sequence:CCGGCTTGTCCTGGACAGCGTATTTCTCGAGAAATACGCTGTCCAGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133791.4-743s21c1
Sequence:CCGGGATGAATATGTGCGGTTAAATCTCGAGATTTAACCGCACATATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133791.4-825s1c1
Sequence:CCGGCCAAATATGATCCTGATATTTCTCGAGAAATATCAGGATCATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133791.4-4746s1c1
Sequence:CCGGCGCATCATAATGAGATCAAACCTCGAGGTTTGATCTCATTATGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133791.4-2762s21c1
Sequence:CCGGCAGATCAGCCTGGCGGATTTACTCGAGTAAATCCGCCAGGCTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133791.4-3374s21c1
Sequence:CCGGCAGTACATCTGCAGGTTAAATCTCGAGATTTAACCTGCAGATGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191769    
Product Details

Region:5UTR
TRC Version: 1.5 Clone ID:NM_133791.1-1248s1c1
Sequence:CCGGGCAGATCAAATTTAGCTGAAACTCGAGTTTCAGCTAAATTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133791
VALIDATED
WWC2 MISSION shRNA shRNA Plasmid DNA
WW and C2 domain containing 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133791.4-4070s21c1
Sequence:CCGGCTTCCGTTTCATACCAGTTTCCTCGAGGAAACTGGTATGAAACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133791.4-2039s21c1
Sequence:CCGGCTTGTCCTGGACAGCGTATTTCTCGAGAAATACGCTGTCCAGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133791.4-743s21c1
Sequence:CCGGGATGAATATGTGCGGTTAAATCTCGAGATTTAACCGCACATATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133791.4-825s1c1
Sequence:CCGGCCAAATATGATCCTGATATTTCTCGAGAAATATCAGGATCATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133791.4-4746s1c1
Sequence:CCGGCGCATCATAATGAGATCAAACCTCGAGGTTTGATCTCATTATGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133791.4-2762s21c1
Sequence:CCGGCAGATCAGCCTGGCGGATTTACTCGAGTAAATCCGCCAGGCTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133791.4-3374s21c1
Sequence:CCGGCAGTACATCTGCAGGTTAAATCTCGAGATTTAACCTGCAGATGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191769    
Product Details

Region:5UTR
TRC Version: 1.5 Clone ID:NM_133791.1-1248s1c1
Sequence:CCGGGCAGATCAAATTTAGCTGAAACTCGAGTTTCAGCTAAATTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133791
VALIDATED
WWC2 MISSION shRNA Lentiviral Transduction Particles
WW and C2 domain containing 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133791.4-4070s21c1
Sequence:CCGGCTTCCGTTTCATACCAGTTTCCTCGAGGAAACTGGTATGAAACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133791.4-2039s21c1
Sequence:CCGGCTTGTCCTGGACAGCGTATTTCTCGAGAAATACGCTGTCCAGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133791.4-743s21c1
Sequence:CCGGGATGAATATGTGCGGTTAAATCTCGAGATTTAACCGCACATATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133791.4-825s1c1
Sequence:CCGGCCAAATATGATCCTGATATTTCTCGAGAAATATCAGGATCATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133791.4-4746s1c1
Sequence:CCGGCGCATCATAATGAGATCAAACCTCGAGGTTTGATCTCATTATGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133791.4-2762s21c1
Sequence:CCGGCAGATCAGCCTGGCGGATTTACTCGAGTAAATCCGCCAGGCTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133791.4-3374s21c1
Sequence:CCGGCAGTACATCTGCAGGTTAAATCTCGAGATTTAACCTGCAGATGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191769    
Product Details

Region:5UTR
TRC Version: 1.5 Clone ID:NM_133791.1-1248s1c1
Sequence:CCGGGCAGATCAAATTTAGCTGAAACTCGAGTTTCAGCTAAATTTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024949
WWC2 MISSION shRNA Bacterial Glycerol Stock
WW and C2 domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024949.3-181s1c1
Sequence:CCGGCCACAGAAACGTACCCAAGATCTCGAGATCTTGGGTACGTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024949.3-1125s1c1
Sequence:CCGGCGTGAAACAACCTAGTGAAATCTCGAGATTTCACTAGGTTGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024949.3-2008s1c1
Sequence:CCGGGCTAATGACAATATGGCAGTTCTCGAGAACTGCCATATTGTCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024949.3-2293s1c1
Sequence:CCGGCTAGACTTAGAACTGGACCTTCTCGAGAAGGTCCAGTTCTAAGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024949.3-2630s1c1
Sequence:CCGGGAGCAAAGATAAGCATCCCATCTCGAGATGGGATGCTTATCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024949.3-2127s1c1
Sequence:CCGGCCAGTACATCTGCAGGTTAAACTCGAGTTTAACCTGCAGATGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024949.3-2284s1c1
Sequence:CCGGCGGACATCTCTAGACTTAGAACTCGAGTTCTAAGTCTAGAGATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024949.3-828s1c1
Sequence:CCGGCCATCAGTTCACTGCTGACTTCTCGAGAAGTCAGCAGTGAACTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024949.3-2604s1c1
Sequence:CCGGCAGGGAGAAGATTGCCTACTTCTCGAGAAGTAGGCAATCTTCTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024949
WWC2 MISSION shRNA shRNA Plasmid DNA
WW and C2 domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024949.3-181s1c1
Sequence:CCGGCCACAGAAACGTACCCAAGATCTCGAGATCTTGGGTACGTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024949.3-1125s1c1
Sequence:CCGGCGTGAAACAACCTAGTGAAATCTCGAGATTTCACTAGGTTGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024949.3-2008s1c1
Sequence:CCGGGCTAATGACAATATGGCAGTTCTCGAGAACTGCCATATTGTCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024949.3-2293s1c1
Sequence:CCGGCTAGACTTAGAACTGGACCTTCTCGAGAAGGTCCAGTTCTAAGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024949.3-2630s1c1
Sequence:CCGGGAGCAAAGATAAGCATCCCATCTCGAGATGGGATGCTTATCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024949.3-2127s1c1
Sequence:CCGGCCAGTACATCTGCAGGTTAAACTCGAGTTTAACCTGCAGATGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024949.3-2284s1c1
Sequence:CCGGCGGACATCTCTAGACTTAGAACTCGAGTTCTAAGTCTAGAGATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024949.3-828s1c1
Sequence:CCGGCCATCAGTTCACTGCTGACTTCTCGAGAAGTCAGCAGTGAACTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024949.3-2604s1c1
Sequence:CCGGCAGGGAGAAGATTGCCTACTTCTCGAGAAGTAGGCAATCTTCTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024949
WWC2 MISSION shRNA Lentiviral Transduction Particles
WW and C2 domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024949.3-181s1c1
Sequence:CCGGCCACAGAAACGTACCCAAGATCTCGAGATCTTGGGTACGTTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024949.3-1125s1c1
Sequence:CCGGCGTGAAACAACCTAGTGAAATCTCGAGATTTCACTAGGTTGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024949.3-2008s1c1
Sequence:CCGGGCTAATGACAATATGGCAGTTCTCGAGAACTGCCATATTGTCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024949.3-2293s1c1
Sequence:CCGGCTAGACTTAGAACTGGACCTTCTCGAGAAGGTCCAGTTCTAAGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024949.3-2630s1c1
Sequence:CCGGGAGCAAAGATAAGCATCCCATCTCGAGATGGGATGCTTATCTTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024949.3-2127s1c1
Sequence:CCGGCCAGTACATCTGCAGGTTAAACTCGAGTTTAACCTGCAGATGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024949.3-2284s1c1
Sequence:CCGGCGGACATCTCTAGACTTAGAACTCGAGTTCTAAGTCTAGAGATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024949.3-828s1c1
Sequence:CCGGCCATCAGTTCACTGCTGACTTCTCGAGAAGTCAGCAGTGAACTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024949.3-2604s1c1
Sequence:CCGGCAGGGAGAAGATTGCCTACTTCTCGAGAAGTAGGCAATCTTCTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks