EMAIL THIS PAGE TO A FRIEND

WWC3

WWC family member 3

Synonyms: BM042
UniProtKB ID: Q9ULE0, A8KA96, Q659C1, Q9BTQ1
Gene ID:
Human(55841) Summary: This gene encodes a member of the WWC family of proteins, which also includes the WWC1 (KIBRA) gene product and the WWC2 gene product. The protein encoded by this gene includes a C2 domain, which is known to mediate homodimerization in the related WWC1 gene product. [provided by RefSeq, Sep 2011]
Rat(317439) WWC family member 3
Zebrafish(566492) WWC family member 3
chicken(418649) WWC family member 3
dog(491735) WWC family member 3
Horse(100049868) WWC family member 3
domestic cat(101088056) WWC family member 3
cow(523454) WWC family member 3
sheep(101119884) WWC family member 3
naked mole-rat(101703375) WWC family member 3
domestic guinea pig(100714997) WWC family member 3
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018458 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015691 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137401 MISSION® esiRNA esiRNA human WWC3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015691 Rosetta Predictions human pricing
XM_001069576 Rosetta Predictions rat pricing
XM_228858 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086620 predicted 3284
2 SASI_Hs01_00086621 predicted 437
3 SASI_Hs01_00086622 predicted 2811
4 SASI_Hs02_00348344 predicted 2902
5 SASI_Hs01_00086624 predicted 212
6 SASI_Hs01_00086625 predicted 1211
7 SASI_Hs01_00086626 predicted 1416
8 SASI_Hs01_00086627 predicted 2733
9 SASI_Hs01_00086628 predicted 655
10 SASI_Hs01_00086629 predicted 1189
11 SASI_Hs01_00086623 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328541 predicted 600
2 SASI_Rn02_00328542 predicted 1610
3 SASI_Rn02_00328543 predicted 1870
4 SASI_Rn02_00328544 predicted 1077
5 SASI_Rn02_00328545 predicted 1101
6 SASI_Rn02_00328546 predicted 1343
7 SASI_Rn02_00328547 predicted 1876
8 SASI_Rn02_00328548 predicted 780
9 SASI_Rn02_00328549 predicted 3175
10 SASI_Rn02_00328550 predicted 2689
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228858 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385585 predicted 2177
2 SASI_Rn02_00385586 predicted 2435
3 SASI_Rn02_00385587 predicted 1639
4 SASI_Rn02_00385588 predicted 1669
5 SASI_Rn02_00385589 predicted 1912
6 SASI_Rn02_00385590 predicted 2445
7 SASI_Rn02_00385591 predicted 1342
8 SASI_Rn02_00385592 predicted 591
9 SASI_Rn02_00385593 predicted 3749
10 SASI_Rn02_00385594 predicted 3256
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018458
VALIDATED
WWC3 MISSION shRNA Bacterial Glycerol Stock
WWC family member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018458.2-252s1c1
Sequence:CCGGGCTGACCGATAGCTTCAAGAACTCGAGTTCTTGAAGCTATCGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018458.2-441s1c1
Sequence:CCGGGCAATATGAAGAAGCCAGAAACTCGAGTTTCTGGCTTCTTCATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018458.2-1787s1c1
Sequence:CCGGCACTTCAGTTATACGTGTGTTCTCGAGAACACACGTATAACTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018458.2-2935s1c1
Sequence:CCGGCAGACCTTTAGGGAGAAGATACTCGAGTATCTTCTCCCTAAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018458.2-2442s1c1
Sequence:CCGGGATTGTCCGTTCCCAGACATTCTCGAGAATGTCTGGGAACGGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018458.2-2353s1c1
Sequence:CCGGGAAGATCTCTTTCTGGAAGAACTCGAGTTCTTCCAGAAAGAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018458.2-736s1c1
Sequence:CCGGCTACTTATGCAGCTGGAAGAACTCGAGTTCTTCCAGCTGCATAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018458.2-1728s1c1
Sequence:CCGGGCTGGTGTTTAACGAAGTGTTCTCGAGAACACTTCGTTAAACACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018458
VALIDATED
WWC3 MISSION shRNA shRNA Plasmid DNA
WWC family member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018458.2-252s1c1
Sequence:CCGGGCTGACCGATAGCTTCAAGAACTCGAGTTCTTGAAGCTATCGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018458.2-441s1c1
Sequence:CCGGGCAATATGAAGAAGCCAGAAACTCGAGTTTCTGGCTTCTTCATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018458.2-1787s1c1
Sequence:CCGGCACTTCAGTTATACGTGTGTTCTCGAGAACACACGTATAACTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018458.2-2935s1c1
Sequence:CCGGCAGACCTTTAGGGAGAAGATACTCGAGTATCTTCTCCCTAAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018458.2-2442s1c1
Sequence:CCGGGATTGTCCGTTCCCAGACATTCTCGAGAATGTCTGGGAACGGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018458.2-2353s1c1
Sequence:CCGGGAAGATCTCTTTCTGGAAGAACTCGAGTTCTTCCAGAAAGAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018458.2-736s1c1
Sequence:CCGGCTACTTATGCAGCTGGAAGAACTCGAGTTCTTCCAGCTGCATAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018458.2-1728s1c1
Sequence:CCGGGCTGGTGTTTAACGAAGTGTTCTCGAGAACACTTCGTTAAACACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018458
VALIDATED
WWC3 MISSION shRNA Lentiviral Transduction Particles
WWC family member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018458.2-252s1c1
Sequence:CCGGGCTGACCGATAGCTTCAAGAACTCGAGTTCTTGAAGCTATCGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018458.2-441s1c1
Sequence:CCGGGCAATATGAAGAAGCCAGAAACTCGAGTTTCTGGCTTCTTCATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018458.2-1787s1c1
Sequence:CCGGCACTTCAGTTATACGTGTGTTCTCGAGAACACACGTATAACTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018458.2-2935s1c1
Sequence:CCGGCAGACCTTTAGGGAGAAGATACTCGAGTATCTTCTCCCTAAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018458.2-2442s1c1
Sequence:CCGGGATTGTCCGTTCCCAGACATTCTCGAGAATGTCTGGGAACGGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018458.2-2353s1c1
Sequence:CCGGGAAGATCTCTTTCTGGAAGAACTCGAGTTCTTCCAGAAAGAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018458.2-736s1c1
Sequence:CCGGCTACTTATGCAGCTGGAAGAACTCGAGTTCTTCCAGCTGCATAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018458.2-1728s1c1
Sequence:CCGGGCTGGTGTTTAACGAAGTGTTCTCGAGAACACTTCGTTAAACACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015691
VALIDATED
WWC3 MISSION shRNA Bacterial Glycerol Stock
WWC family member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015691.3-2193s21c1
Sequence:CCGGGCTGGTGTTTAACGAAGTGTTCTCGAGAACACTTCGTTAAACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015691.3-3400s21c1
Sequence:CCGGCAGACCTTTAGGGAGAAGATACTCGAGTATCTTCTCCCTAAAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015691.3-717s21c1
Sequence:CCGGGCTGACCGATAGCTTCAAGAACTCGAGTTCTTGAAGCTATCGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015691.3-906s21c1
Sequence:CCGGGCAATATGAAGAAGCCAGAAACTCGAGTTTCTGGCTTCTTCATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015691.3-3956s21c1
Sequence:CCGGGCGAACGCTATGTGCTAAATTCTCGAGAATTTAGCACATAGCGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015691
VALIDATED
WWC3 MISSION shRNA shRNA Plasmid DNA
WWC family member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015691.3-2193s21c1
Sequence:CCGGGCTGGTGTTTAACGAAGTGTTCTCGAGAACACTTCGTTAAACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015691.3-3400s21c1
Sequence:CCGGCAGACCTTTAGGGAGAAGATACTCGAGTATCTTCTCCCTAAAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015691.3-717s21c1
Sequence:CCGGGCTGACCGATAGCTTCAAGAACTCGAGTTCTTGAAGCTATCGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015691.3-906s21c1
Sequence:CCGGGCAATATGAAGAAGCCAGAAACTCGAGTTTCTGGCTTCTTCATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015691.3-3956s21c1
Sequence:CCGGGCGAACGCTATGTGCTAAATTCTCGAGAATTTAGCACATAGCGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015691
VALIDATED
WWC3 MISSION shRNA Lentiviral Transduction Particles
WWC family member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015691.3-2193s21c1
Sequence:CCGGGCTGGTGTTTAACGAAGTGTTCTCGAGAACACTTCGTTAAACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015691.3-3400s21c1
Sequence:CCGGCAGACCTTTAGGGAGAAGATACTCGAGTATCTTCTCCCTAAAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015691.3-717s21c1
Sequence:CCGGGCTGACCGATAGCTTCAAGAACTCGAGTTCTTGAAGCTATCGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015691.3-906s21c1
Sequence:CCGGGCAATATGAAGAAGCCAGAAACTCGAGTTTCTGGCTTCTTCATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015691.3-3956s21c1
Sequence:CCGGGCGAACGCTATGTGCTAAATTCTCGAGAATTTAGCACATAGCGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks