EMAIL THIS PAGE TO A FRIEND

WWOX

WW domain containing oxidoreductase

Synonyms: D16S432E FOR FRA16D HHCMA56 PRO0128 SDR41C1 WOX1
Gene ID:
Human(51741) Summary: WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 2 WW domains and a short-chain dehydrogenase/reductase domain (SRD). The highest normal expression of this gene is detected in hormonally regulated tissues such as testis, ovary, and prostate. This expression pattern and the presence of an SRD domain suggest a role for this gene in steroid metabolism. The encoded protein is more than 90% identical to the mouse protein, which is an essential mediator of tumor necrosis factor-alpha-induced apoptosis, suggesting a similar, important role in apoptosis for the human protein. In addition, there is evidence that this gene behaves as a suppressor of tumor growth. Alternative splicing of this gene generates transcript variants that encode different isoforms. [provided by RefSeq, Jul 2008]
Mouse(80707) WW domain-containing oxidoreductase
Rat(292041) WW domain-containing oxidoreductase
fruit fly(34090) WW domain containing oxidoreductase
chicken(415801) WW domain containing oxidoreductase
Zebrafish(393887) WW domain containing oxidoreductase
Horse(100055545) WW domain containing oxidoreductase
domestic cat(101093411) WW domain containing oxidoreductase
dog(610120) WW domain containing oxidoreductase
domestic guinea pig(100722863) WW domain containing oxidoreductase
naked mole-rat(101698327) WW domain containing oxidoreductase
Domestic Rabbit(100353596) WW domain containing oxidoreductase
cow(618792) WW domain containing oxidoreductase
sheep(101120431) WW domain containing oxidoreductase
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016373 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019573 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019573 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019573 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016373 Rosetta Predictions human pricing
NM_130791 Rosetta Predictions human pricing
NM_130844 Rosetta Predictions human pricing
NM_001106188 Rosetta Predictions rat pricing
NM_019573 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349365 predicted 303
2 SASI_Hs01_00141985 predicted 199
3 SASI_Hs01_00141986 predicted 245
4 SASI_Hs01_00141987 predicted 385
5 SASI_Hs01_00141988 predicted 240
6 SASI_Hs01_00141989 predicted 215
7 SASI_Hs01_00141990 predicted 380
8 SASI_Hs01_00141991 predicted 385
9 SASI_Hs01_00141992 predicted 199
10 SASI_Hs01_00141993 predicted 396
11 SASI_Hs01_00141984 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362824 predicted 299
2 SASI_Hs01_00181733 predicted 200
3 SASI_Hs01_00181734 predicted 239
4 SASI_Hs01_00181735 predicted 385
5 SASI_Hs01_00181736 predicted 246
6 SASI_Hs01_00181737 predicted 208
7 SASI_Hs01_00181738 predicted 381
8 SASI_Hs01_00181739 predicted 383
9 SASI_Hs01_00181740 predicted 204
10 SASI_Hs01_00181741 predicted 399
11 SASI_Hs01_00181732 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056783 predicted 198
2 SASI_Hs01_00056784 predicted 317
3 SASI_Hs01_00056785 predicted 317
4 SASI_Hs01_00056786 predicted 209
5 SASI_Hs01_00056787 predicted 323
6 SASI_Hs01_00056788 predicted 207
7 SASI_Hs01_00056790 predicted 198
8 SASI_Hs01_00056791 predicted 212
9 SASI_Hs01_00056792 predicted 208
10 SASI_Hs02_00362888 predicted 310
11 SASI_Hs01_00056789 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216498 predicted 476
2 SASI_Rn02_00216499 predicted 772
3 SASI_Rn02_00216500 predicted 1219
4 SASI_Rn02_00216501 predicted 964
5 SASI_Rn02_00216502 predicted 492
6 SASI_Rn02_00216503 predicted 1230
7 SASI_Rn02_00216504 predicted 884
8 SASI_Rn02_00216505 predicted 366
9 SASI_Rn02_00216506 predicted 681
10 SASI_Rn02_00216507 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119327 predicted 964
2 SASI_Mm01_00119328 predicted 743
3 SASI_Mm01_00119329 predicted 1417
4 SASI_Mm01_00119331 predicted 945
5 SASI_Mm01_00119332 predicted 228
6 SASI_Mm02_00324628 predicted 1421
7 SASI_Mm01_00119334 predicted 953
8 SASI_Mm02_00324629 predicted 778
9 SASI_Mm01_00119335 predicted 515
10 SASI_Mm01_00119336 predicted 470
11 SASI_Mm01_00119330 predicted 350
12 SASI_Mm01_00119333 predicted 860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016373
VALIDATED
WWOX MISSION shRNA Bacterial Glycerol Stock
WW domain containing oxidoreductase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016373.1-1576s21c1
Sequence:CCGGGGCTAGGCATAGGTCTCTTTGCTCGAGCAAAGAGACCTATGCCTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016373.1-610s21c1
Sequence:CCGGGTGAAGCAGTGTCACGCATTTCTCGAGAAATGCGTGACACTGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016373.1-1463s21c1
Sequence:CCGGACACAGATCCGCAAGAGTAAACTCGAGTTTACTCTTGCGGATCTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016373.1-1099s21c1
Sequence:CCGGATATGATGTACTCCAACATTCCTCGAGGAATGTTGGAGTACATCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016373.1-910s1c1
Sequence:CCGGCCCATCGATTTACAGATATTACTCGAGTAATATCTGTAAATCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016373.1-995s1c1
Sequence:CCGGGCTGGCTTATAACAGGTCCAACTCGAGTTGGACCTGTTATAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_016373.1-303s1c1
Sequence:CCGGCCATACGGATGGGAACAAGAACTCGAGTTCTTGTTCCCATCCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016373.1-396s1c1
Sequence:CCGGGCGTTTACTGTGGATGATAATCTCGAGATTATCATCCACAGTAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016373.1-720s1c1
Sequence:CCGGGCCAAGAATGTGCCTCTTCATCTCGAGATGAAGAGGCACATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016373
VALIDATED
WWOX MISSION shRNA shRNA Plasmid DNA
WW domain containing oxidoreductase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016373.1-1576s21c1
Sequence:CCGGGGCTAGGCATAGGTCTCTTTGCTCGAGCAAAGAGACCTATGCCTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016373.1-610s21c1
Sequence:CCGGGTGAAGCAGTGTCACGCATTTCTCGAGAAATGCGTGACACTGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016373.1-1463s21c1
Sequence:CCGGACACAGATCCGCAAGAGTAAACTCGAGTTTACTCTTGCGGATCTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016373.1-1099s21c1
Sequence:CCGGATATGATGTACTCCAACATTCCTCGAGGAATGTTGGAGTACATCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016373.1-910s1c1
Sequence:CCGGCCCATCGATTTACAGATATTACTCGAGTAATATCTGTAAATCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016373.1-995s1c1
Sequence:CCGGGCTGGCTTATAACAGGTCCAACTCGAGTTGGACCTGTTATAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_016373.1-303s1c1
Sequence:CCGGCCATACGGATGGGAACAAGAACTCGAGTTCTTGTTCCCATCCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016373.1-396s1c1
Sequence:CCGGGCGTTTACTGTGGATGATAATCTCGAGATTATCATCCACAGTAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016373.1-720s1c1
Sequence:CCGGGCCAAGAATGTGCCTCTTCATCTCGAGATGAAGAGGCACATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016373
VALIDATED
WWOX MISSION shRNA Lentiviral Transduction Particles
WW domain containing oxidoreductase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016373.1-1576s21c1
Sequence:CCGGGGCTAGGCATAGGTCTCTTTGCTCGAGCAAAGAGACCTATGCCTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016373.1-610s21c1
Sequence:CCGGGTGAAGCAGTGTCACGCATTTCTCGAGAAATGCGTGACACTGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016373.1-1463s21c1
Sequence:CCGGACACAGATCCGCAAGAGTAAACTCGAGTTTACTCTTGCGGATCTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016373.1-1099s21c1
Sequence:CCGGATATGATGTACTCCAACATTCCTCGAGGAATGTTGGAGTACATCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016373.1-910s1c1
Sequence:CCGGCCCATCGATTTACAGATATTACTCGAGTAATATCTGTAAATCGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016373.1-995s1c1
Sequence:CCGGGCTGGCTTATAACAGGTCCAACTCGAGTTGGACCTGTTATAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_016373.1-303s1c1
Sequence:CCGGCCATACGGATGGGAACAAGAACTCGAGTTCTTGTTCCCATCCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016373.1-396s1c1
Sequence:CCGGGCGTTTACTGTGGATGATAATCTCGAGATTATCATCCACAGTAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016373.1-720s1c1
Sequence:CCGGGCCAAGAATGTGCCTCTTCATCTCGAGATGAAGAGGCACATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019573
WWOX MISSION shRNA Bacterial Glycerol Stock
WW domain containing oxidoreductase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019573.2-861s1c1
Sequence:CCGGCCCACAGATTTACAGATATTACTCGAGTAATATCTGTAAATCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019573.2-659s1c1
Sequence:CCGGGAAGCATTCAAGGCCAAGAATCTCGAGATTCTTGGCCTTGAATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019573.2-178s1c1
Sequence:CCGGCGCCAATCACACTGAGGAGAACTCGAGTTCTCCTCAGTGTGATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019573.2-1189s1c1
Sequence:CCGGCGGAGGGATGTATTTCAACAACTCGAGTTGTTGAAATACATCCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019573.2-946s1c1
Sequence:CCGGGCTGGCTTATAACAGATCTAACTCGAGTTAGATCTGTTATAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019573
WWOX MISSION shRNA shRNA Plasmid DNA
WW domain containing oxidoreductase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019573.2-861s1c1
Sequence:CCGGCCCACAGATTTACAGATATTACTCGAGTAATATCTGTAAATCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019573.2-659s1c1
Sequence:CCGGGAAGCATTCAAGGCCAAGAATCTCGAGATTCTTGGCCTTGAATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019573.2-178s1c1
Sequence:CCGGCGCCAATCACACTGAGGAGAACTCGAGTTCTCCTCAGTGTGATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019573.2-1189s1c1
Sequence:CCGGCGGAGGGATGTATTTCAACAACTCGAGTTGTTGAAATACATCCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019573.2-946s1c1
Sequence:CCGGGCTGGCTTATAACAGATCTAACTCGAGTTAGATCTGTTATAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019573
WWOX MISSION shRNA Lentiviral Transduction Particles
WW domain containing oxidoreductase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019573.2-861s1c1
Sequence:CCGGCCCACAGATTTACAGATATTACTCGAGTAATATCTGTAAATCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019573.2-659s1c1
Sequence:CCGGGAAGCATTCAAGGCCAAGAATCTCGAGATTCTTGGCCTTGAATGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019573.2-178s1c1
Sequence:CCGGCGCCAATCACACTGAGGAGAACTCGAGTTCTCCTCAGTGTGATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019573.2-1189s1c1
Sequence:CCGGCGGAGGGATGTATTTCAACAACTCGAGTTGTTGAAATACATCCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019573.2-946s1c1
Sequence:CCGGGCTGGCTTATAACAGATCTAACTCGAGTTAGATCTGTTATAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks