EMAIL THIS PAGE TO A FRIEND

WWP1

WW domain containing E3 ubiquitin protein ligase 1

Synonyms: AIP5 Tiul1 hSDRP1
UniProtKB ID: Q9H0M0, O00307, Q5YLC1, Q96BP4
Gene ID:
Human(11059) Summary: WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. [provided by RefSeq, Jul 2008]
Mouse(107568) WW domain containing E3 ubiquitin protein ligase 1
Rat(297930) WW domain containing E3 ubiquitin protein ligase 1
chicken(420212) WW domain containing E3 ubiquitin protein ligase 1
dog(477930) WW domain containing E3 ubiquitin protein ligase 1
Horse(100055725) WW domain containing E3 ubiquitin protein ligase 1
domestic cat(101095882) WW domain containing E3 ubiquitin protein ligase 1
cow(513789) WW domain containing E3 ubiquitin protein ligase 1
sheep(101117426) WW domain containing E3 ubiquitin protein ligase 1
Domestic Rabbit(100350478) WW domain containing E3 ubiquitin protein ligase 1
naked mole-rat(101725489) WW domain containing E3 ubiquitin protein ligase 1
domestic guinea pig(100715948) WW domain containing E3 ubiquitin protein ligase 1
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_130163 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_130163 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_130163 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007013 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007013 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007013 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177327 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177327 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177327 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007013 Rosetta Predictions human pricing
NM_001024757 Rosetta Predictions rat pricing
NM_177327 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236581 predicted 2839
2 SASI_Hs02_00342771 predicted 1684
3 SASI_Hs01_00236583 predicted 1935
4 SASI_Hs02_00342772 predicted 1963
5 SASI_Hs01_00236586 predicted 575
6 SASI_Hs02_00342773 predicted 1673
7 SASI_Hs01_00236587 predicted 660
8 SASI_Hs01_00236588 predicted 1603
9 SASI_Hs02_00342774 predicted 2507
10 SASI_Hs01_00236589 predicted 2280
11 SASI_Hs01_00236582 predicted 1377
12 SASI_Hs01_00236584 predicted 2979
13 SASI_Hs01_00236585 predicted 2220
14 SASI_Hs01_00236590 predicted 1283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049986 predicted 2746
2 SASI_Rn01_00049987 predicted 2325
3 SASI_Rn01_00049988 predicted 1333
4 SASI_Rn02_00202635 predicted 1863
5 SASI_Rn01_00049989 predicted 2239
6 SASI_Rn01_00049991 predicted 2056
7 SASI_Rn01_00049992 predicted 808
8 SASI_Rn01_00049993 predicted 655
9 SASI_Rn01_00049994 predicted 1904
10 SASI_Rn02_00202636 predicted 270
11 SASI_Rn01_00049990 predicted 1349
12 SASI_Rn01_00049995 predicted 1566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177327 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347423 predicted 437
2 SASI_Mm02_00347424 predicted 1349
3 SASI_Mm02_00347425 predicted 1491
4 SASI_Mm02_00347426 predicted 1949
5 SASI_Mm02_00347427 predicted 2370
6 SASI_Mm02_00347428 predicted 818
7 SASI_Mm02_00347429 predicted 324
8 SASI_Mm02_00347430 predicted 667
9 SASI_Mm02_00347431 predicted 1934
10 SASI_Mm02_00347432 predicted 281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_130163
VALIDATED
WWP1 MISSION shRNA Bacterial Glycerol Stock
WW domain containing E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130163.3-492s1c1
Sequence:CCGGACAAGAATGGAATAGTGCAAACTCGAGTTTGCACTATTCCATTCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130163.3-429s1c1
Sequence:CCGGTGCTGTTAACACACAACAGAACTCGAGTTCTGTTGTGTGTTAACAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130163.3-360s1c1
Sequence:CCGGGAGTTTGGAGTCACCACACTTCTCGAGAAGTGTGGTGACTCCAAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130163.3-371s1c1
Sequence:CCGGCACCACACTTTAAAGGCAGATCTCGAGATCTGCCTTTAAAGTGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130163.3-407s1c1
Sequence:CCGGGCAACAGTGGACTTGAAACAACTCGAGTTGTTTCAAGTCCACTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_130163
VALIDATED
WWP1 MISSION shRNA shRNA Plasmid DNA
WW domain containing E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130163.3-492s1c1
Sequence:CCGGACAAGAATGGAATAGTGCAAACTCGAGTTTGCACTATTCCATTCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130163.3-429s1c1
Sequence:CCGGTGCTGTTAACACACAACAGAACTCGAGTTCTGTTGTGTGTTAACAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130163.3-360s1c1
Sequence:CCGGGAGTTTGGAGTCACCACACTTCTCGAGAAGTGTGGTGACTCCAAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130163.3-371s1c1
Sequence:CCGGCACCACACTTTAAAGGCAGATCTCGAGATCTGCCTTTAAAGTGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130163.3-407s1c1
Sequence:CCGGGCAACAGTGGACTTGAAACAACTCGAGTTGTTTCAAGTCCACTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_130163
VALIDATED
WWP1 MISSION shRNA Lentiviral Transduction Particles
WW domain containing E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130163.3-492s1c1
Sequence:CCGGACAAGAATGGAATAGTGCAAACTCGAGTTTGCACTATTCCATTCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130163.3-429s1c1
Sequence:CCGGTGCTGTTAACACACAACAGAACTCGAGTTCTGTTGTGTGTTAACAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130163.3-360s1c1
Sequence:CCGGGAGTTTGGAGTCACCACACTTCTCGAGAAGTGTGGTGACTCCAAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130163.3-371s1c1
Sequence:CCGGCACCACACTTTAAAGGCAGATCTCGAGATCTGCCTTTAAAGTGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130163.3-407s1c1
Sequence:CCGGGCAACAGTGGACTTGAAACAACTCGAGTTGTTTCAAGTCCACTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007013
VALIDATED
WWP1 MISSION shRNA Bacterial Glycerol Stock
WW domain containing E3 ubiquitin protein ligase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007013.x-2166s1c1
Sequence:CCGGGCTTATTTGAGTATGCGGGCACTCGAGTGCCCGCATACTCAAATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_007013.x-1901s1c1
Sequence:CCGGATTGCTTATGAACGCGGCTTTCTCGAGAAAGCCGCGTTCATAAGCAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_007013.x-4055s1c1
Sequence:CCGGCCTCTCAAATTCATAACAGTTCTCGAGAACTGTTATGAATTTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007013.x-912s1c1
Sequence:CCGGACAACACACCTTCATCTCCGTCTCGAGACGGAGATGAAGGTGTGTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007013.x-1877s1c1
Sequence:CCGGTCTGTAACTAAAGGTGGTCCACTCGAGTGGACCACCTTTAGTTACAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_007013.3-1901s21c1
Sequence:CCGGATTGCTTATGAACGCGGCTTTCTCGAGAAAGCCGCGTTCATAAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_007013.3-1519s21c1
Sequence:CCGGCATGGAATCTGTCCGAAATTTCTCGAGAAATTTCGGACAGATTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007013.3-3501s21c1
Sequence:CCGGGCTGTTCAGAAAGGTATTAAGCTCGAGCTTAATACCTTTCTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_007013.3-1877s21c1
Sequence:CCGGTCTGTAACTAAAGGTGGTCCACTCGAGTGGACCACCTTTAGTTACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007013.3-2051s21c1
Sequence:CCGGGACTTGAGGAGGCGCTTATATCTCGAGATATAAGCGCCTCCTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007013
VALIDATED
WWP1 MISSION shRNA shRNA Plasmid DNA
WW domain containing E3 ubiquitin protein ligase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007013.x-2166s1c1
Sequence:CCGGGCTTATTTGAGTATGCGGGCACTCGAGTGCCCGCATACTCAAATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_007013.x-1901s1c1
Sequence:CCGGATTGCTTATGAACGCGGCTTTCTCGAGAAAGCCGCGTTCATAAGCAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_007013.x-4055s1c1
Sequence:CCGGCCTCTCAAATTCATAACAGTTCTCGAGAACTGTTATGAATTTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007013.x-912s1c1
Sequence:CCGGACAACACACCTTCATCTCCGTCTCGAGACGGAGATGAAGGTGTGTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007013.x-1877s1c1
Sequence:CCGGTCTGTAACTAAAGGTGGTCCACTCGAGTGGACCACCTTTAGTTACAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_007013.3-1901s21c1
Sequence:CCGGATTGCTTATGAACGCGGCTTTCTCGAGAAAGCCGCGTTCATAAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_007013.3-1519s21c1
Sequence:CCGGCATGGAATCTGTCCGAAATTTCTCGAGAAATTTCGGACAGATTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007013.3-3501s21c1
Sequence:CCGGGCTGTTCAGAAAGGTATTAAGCTCGAGCTTAATACCTTTCTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_007013.3-1877s21c1
Sequence:CCGGTCTGTAACTAAAGGTGGTCCACTCGAGTGGACCACCTTTAGTTACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007013.3-2051s21c1
Sequence:CCGGGACTTGAGGAGGCGCTTATATCTCGAGATATAAGCGCCTCCTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007013
VALIDATED
WWP1 MISSION shRNA Lentiviral Transduction Particles
WW domain containing E3 ubiquitin protein ligase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007013.x-2166s1c1
Sequence:CCGGGCTTATTTGAGTATGCGGGCACTCGAGTGCCCGCATACTCAAATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_007013.x-1901s1c1
Sequence:CCGGATTGCTTATGAACGCGGCTTTCTCGAGAAAGCCGCGTTCATAAGCAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_007013.x-4055s1c1
Sequence:CCGGCCTCTCAAATTCATAACAGTTCTCGAGAACTGTTATGAATTTGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007013.x-912s1c1
Sequence:CCGGACAACACACCTTCATCTCCGTCTCGAGACGGAGATGAAGGTGTGTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_007013.x-1877s1c1
Sequence:CCGGTCTGTAACTAAAGGTGGTCCACTCGAGTGGACCACCTTTAGTTACAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_007013.3-1901s21c1
Sequence:CCGGATTGCTTATGAACGCGGCTTTCTCGAGAAAGCCGCGTTCATAAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_007013.3-1519s21c1
Sequence:CCGGCATGGAATCTGTCCGAAATTTCTCGAGAAATTTCGGACAGATTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007013.3-3501s21c1
Sequence:CCGGGCTGTTCAGAAAGGTATTAAGCTCGAGCTTAATACCTTTCTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_007013.3-1877s21c1
Sequence:CCGGTCTGTAACTAAAGGTGGTCCACTCGAGTGGACCACCTTTAGTTACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007013.3-2051s21c1
Sequence:CCGGGACTTGAGGAGGCGCTTATATCTCGAGATATAAGCGCCTCCTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177327
WWP1 MISSION shRNA Bacterial Glycerol Stock
WW domain containing E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177327.3-646s21c1
Sequence:CCGGACAAGAATGGAATAGTGCAAACTCGAGTTTGCACTATTCCATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177327.3-514s21c1
Sequence:CCGGGAGTTTGGAGTCACCACACTTCTCGAGAAGTGTGGTGACTCCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177327.3-561s21c1
Sequence:CCGGGCAACAGTGGACTTGAAACAACTCGAGTTGTTTCAAGTCCACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177327.3-583s21c1
Sequence:CCGGTGCTGTTAACACACAACAGAACTCGAGTTCTGTTGTGTGTTAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177327.3-525s21c1
Sequence:CCGGCACCACACTTTAAAGGCAGATCTCGAGATCTGCCTTTAAAGTGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177327
WWP1 MISSION shRNA shRNA Plasmid DNA
WW domain containing E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177327.3-646s21c1
Sequence:CCGGACAAGAATGGAATAGTGCAAACTCGAGTTTGCACTATTCCATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177327.3-514s21c1
Sequence:CCGGGAGTTTGGAGTCACCACACTTCTCGAGAAGTGTGGTGACTCCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177327.3-561s21c1
Sequence:CCGGGCAACAGTGGACTTGAAACAACTCGAGTTGTTTCAAGTCCACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177327.3-583s21c1
Sequence:CCGGTGCTGTTAACACACAACAGAACTCGAGTTCTGTTGTGTGTTAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177327.3-525s21c1
Sequence:CCGGCACCACACTTTAAAGGCAGATCTCGAGATCTGCCTTTAAAGTGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177327
WWP1 MISSION shRNA Lentiviral Transduction Particles
WW domain containing E3 ubiquitin protein ligase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177327.3-646s21c1
Sequence:CCGGACAAGAATGGAATAGTGCAAACTCGAGTTTGCACTATTCCATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177327.3-514s21c1
Sequence:CCGGGAGTTTGGAGTCACCACACTTCTCGAGAAGTGTGGTGACTCCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177327.3-561s21c1
Sequence:CCGGGCAACAGTGGACTTGAAACAACTCGAGTTGTTTCAAGTCCACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177327.3-583s21c1
Sequence:CCGGTGCTGTTAACACACAACAGAACTCGAGTTCTGTTGTGTGTTAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177327.3-525s21c1
Sequence:CCGGCACCACACTTTAAAGGCAGATCTCGAGATCTGCCTTTAAAGTGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks