EMAIL THIS PAGE TO A FRIEND

WWP2

WW domain containing E3 ubiquitin protein ligase 2

Synonyms: AIP2 WWp2-like
Gene ID:
Human(11060) Summary: This gene encodes a member of the Nedd4 family of E3 ligases, which play an important role in protein ubiquitination. The encoded protein contains four WW domains and may play a role in multiple processes including chondrogenesis and the regulation of oncogenic signaling pathways via interactions with Smad proteins and the tumor suppressor PTEN. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 10. [provided by RefSeq, Jul 2012]
Mouse(66894) WW domain containing E3 ubiquitin protein ligase 2
Rat(291999) WW domain containing E3 ubiquitin protein ligase 2
Zebrafish(564527) WW domain containing E3 ubiquitin protein ligase 2
Horse(100067291) WW domain containing E3 ubiquitin protein ligase 2
domestic cat(101098349) WW domain containing E3 ubiquitin protein ligase 2
dog(479672) WW domain containing E3 ubiquitin protein ligase 2
chicken(415868) WW domain containing E3 ubiquitin protein ligase 2
domestic guinea pig(100721341) WW domain containing E3 ubiquitin protein ligase 2
naked mole-rat(101710527) WW domain containing E3 ubiquitin protein ligase 2
cow(512457) WW domain containing E3 ubiquitin protein ligase 2
sheep(101122376) WW domain containing E3 ubiquitin protein ligase 2
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
W1644 Anti-WWP2 (338-350) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV43088 Anti-WWP2 (AB1) antibody produced in rabbit affinity isolated antibody bovine, canine, rabbit, mouse, horse, guinea pig, zebrafish, sheep, human, rat
immunohistochemistry, western blot pricing
AV43089 Anti-WWP2 (AB2) antibody produced in rabbit affinity isolated antibody bovine, human, mouse, horse, canine, rabbit, rat, guinea pig
western blot pricing
SAB1407097 Anti-WWP2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2108263 Anti-WWP2 antibody produced in rabbit affinity isolated antibody rat, bovine, zebrafish, mouse, rabbit, guinea pig, canine, horse, human
western blot pricing
SAB2103030 Anti-WWP2 antibody produced in rabbit affinity isolated antibody canine, bovine, guinea pig, rabbit, mouse, horse, zebrafish, rat, human
western blot pricing
SAB2103031 Anti-WWP2 antibody produced in rabbit affinity isolated antibody, lyophilized powder rat, horse, rabbit, canine, bovine, zebrafish, human, mouse, chicken
western blot pricing
HPA041682 Anti-WWP2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1410153 Anti-WWP2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025830 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025830 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025830 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007014 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007014 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007014 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059111 MISSION® esiRNA esiRNA human WWP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007014 Rosetta Predictions human pricing
NM_199423 Rosetta Predictions human pricing
NM_199424 Rosetta Predictions human pricing
NM_001106184 Rosetta Predictions rat pricing
NM_025830 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096784 predicted 2019
2 SASI_Hs01_00096785 predicted 1897
3 SASI_Hs01_00096786 predicted 2350
4 SASI_Hs01_00096787 predicted 1458
5 SASI_Hs01_00096788 predicted 1804
6 SASI_Hs01_00096790 predicted 2043
7 SASI_Hs02_00342775 predicted 1462
8 SASI_Hs01_00096791 predicted 2622
9 SASI_Hs02_00342776 predicted 1898
10 SASI_Hs01_00096793 predicted 1916
11 SASI_Hs01_00096789 predicted 2526
12 SASI_Hs01_00096792 predicted 2554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203351 predicted 274
2 SASI_Hs01_00203352 predicted 519
3 SASI_Hs01_00203353 predicted 389
4 SASI_Hs01_00203354 predicted 746
5 SASI_Hs01_00203355 predicted 264
6 SASI_Hs01_00203356 predicted 482
7 SASI_Hs01_00203357 predicted 308
8 SASI_Hs01_00203358 predicted 515
9 SASI_Hs01_00203359 predicted 320
10 SASI_Hs01_00203360 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089920 predicted 1181
2 SASI_Hs01_00089921 predicted 1066
3 SASI_Hs01_00089922 predicted 1515
4 SASI_Hs01_00089923 predicted 625
5 SASI_Hs01_00089924 predicted 967
6 SASI_Hs01_00089926 predicted 1213
7 SASI_Hs02_00372823 predicted 621
8 SASI_Hs01_00089927 predicted 1781
9 SASI_Hs02_00372824 predicted 1061
10 SASI_Hs01_00089929 predicted 1077
11 SASI_Hs01_00089925 predicted 1698
12 SASI_Hs01_00089928 predicted 1725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216458 predicted 1234
2 SASI_Rn02_00216459 predicted 270
3 SASI_Rn02_00216460 predicted 1320
4 SASI_Rn02_00216461 predicted 1164
5 SASI_Rn02_00216462 predicted 697
6 SASI_Rn02_00216463 predicted 393
7 SASI_Rn02_00216464 predicted 1027
8 SASI_Rn02_00216465 predicted 1844
9 SASI_Rn02_00216466 predicted 342
10 SASI_Rn02_00216467 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036360 predicted 1215
2 SASI_Mm01_00036361 predicted 1146
3 SASI_Mm01_00036362 predicted 1621
4 SASI_Mm01_00036363 predicted 1300
5 SASI_Mm02_00329093 predicted 1825
6 SASI_Mm01_00036364 predicted 321
7 SASI_Mm01_00036365 predicted 1986
8 SASI_Mm01_00036366 predicted 1880
9 SASI_Mm01_00036367 predicted 1466
10 SASI_Mm01_00036368 predicted 1155
11 SASI_Mm01_00036369 predicted 726
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025830
VALIDATED
WWP2 MISSION shRNA Bacterial Glycerol Stock
WW domain containing E3 ubiquitin protein ligase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025830.3-1874s21c1
Sequence:CCGGCCGCTTTATCGGCAGATTCATCTCGAGATGAATCTGCCGATAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025830.3-1208s21c1
Sequence:CCGGGCAGCACTTCAGCCAAAGATTCTCGAGAATCTTTGGCTGAAGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025830.3-3453s21c1
Sequence:CCGGGCCCTCTTGATTCAGTAGCTTCTCGAGAAGCTACTGAATCAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025830.3-802s21c1
Sequence:CCGGCGTCGGTTGTTGGTGTAACATCTCGAGATGTTACACCAACAACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025830.3-991s21c1
Sequence:CCGGTGCCCAATGGGCGTGTCTATTCTCGAGAATAGACACGCCCATTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025830.3-3453s1c1
Sequence:CCGGGCCCTCTTGATTCAGTAGCTTCTCGAGAAGCTACTGAATCAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025830.3-1874s1c1
Sequence:CCGGCCGCTTTATCGGCAGATTCATCTCGAGATGAATCTGCCGATAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025830.3-1208s1c1
Sequence:CCGGGCAGCACTTCAGCCAAAGATTCTCGAGAATCTTTGGCTGAAGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025830.3-802s1c1
Sequence:CCGGCGTCGGTTGTTGGTGTAACATCTCGAGATGTTACACCAACAACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025830.3-1871s1c1
Sequence:CCGGCTTCCGCTTTATCGGCAGATTCTCGAGAATCTGCCGATAAAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025830
VALIDATED
WWP2 MISSION shRNA shRNA Plasmid DNA
WW domain containing E3 ubiquitin protein ligase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025830.3-1874s21c1
Sequence:CCGGCCGCTTTATCGGCAGATTCATCTCGAGATGAATCTGCCGATAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025830.3-1208s21c1
Sequence:CCGGGCAGCACTTCAGCCAAAGATTCTCGAGAATCTTTGGCTGAAGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025830.3-3453s21c1
Sequence:CCGGGCCCTCTTGATTCAGTAGCTTCTCGAGAAGCTACTGAATCAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025830.3-802s21c1
Sequence:CCGGCGTCGGTTGTTGGTGTAACATCTCGAGATGTTACACCAACAACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025830.3-991s21c1
Sequence:CCGGTGCCCAATGGGCGTGTCTATTCTCGAGAATAGACACGCCCATTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025830.3-3453s1c1
Sequence:CCGGGCCCTCTTGATTCAGTAGCTTCTCGAGAAGCTACTGAATCAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025830.3-1874s1c1
Sequence:CCGGCCGCTTTATCGGCAGATTCATCTCGAGATGAATCTGCCGATAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025830.3-1208s1c1
Sequence:CCGGGCAGCACTTCAGCCAAAGATTCTCGAGAATCTTTGGCTGAAGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025830.3-802s1c1
Sequence:CCGGCGTCGGTTGTTGGTGTAACATCTCGAGATGTTACACCAACAACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025830.3-1871s1c1
Sequence:CCGGCTTCCGCTTTATCGGCAGATTCTCGAGAATCTGCCGATAAAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025830
VALIDATED
WWP2 MISSION shRNA Lentiviral Transduction Particles
WW domain containing E3 ubiquitin protein ligase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025830.3-1874s21c1
Sequence:CCGGCCGCTTTATCGGCAGATTCATCTCGAGATGAATCTGCCGATAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025830.3-1208s21c1
Sequence:CCGGGCAGCACTTCAGCCAAAGATTCTCGAGAATCTTTGGCTGAAGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025830.3-3453s21c1
Sequence:CCGGGCCCTCTTGATTCAGTAGCTTCTCGAGAAGCTACTGAATCAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025830.3-802s21c1
Sequence:CCGGCGTCGGTTGTTGGTGTAACATCTCGAGATGTTACACCAACAACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025830.3-991s21c1
Sequence:CCGGTGCCCAATGGGCGTGTCTATTCTCGAGAATAGACACGCCCATTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025830.3-3453s1c1
Sequence:CCGGGCCCTCTTGATTCAGTAGCTTCTCGAGAAGCTACTGAATCAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025830.3-1874s1c1
Sequence:CCGGCCGCTTTATCGGCAGATTCATCTCGAGATGAATCTGCCGATAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025830.3-1208s1c1
Sequence:CCGGGCAGCACTTCAGCCAAAGATTCTCGAGAATCTTTGGCTGAAGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025830.3-802s1c1
Sequence:CCGGCGTCGGTTGTTGGTGTAACATCTCGAGATGTTACACCAACAACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025830.3-1871s1c1
Sequence:CCGGCTTCCGCTTTATCGGCAGATTCTCGAGAATCTGCCGATAAAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007014
VALIDATED
WWP2 MISSION shRNA Bacterial Glycerol Stock
WW domain containing E3 ubiquitin protein ligase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_007014.3-316s21c1
Sequence:CCGGCGGCACAGAGTCATTTAGATTCTCGAGAATCTAAATGACTCTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_007014.3-2299s21c1
Sequence:CCGGTGCGCTACTTTGACGAGAAAGCTCGAGCTTTCTCGTCAAAGTAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_007014.3-1893s21c1
Sequence:CCGGCTCACCTACTTTCGCTTTATACTCGAGTATAAAGCGAAAGTAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007014.3-174s21c1
Sequence:CCGGCCCAAGGTGCATAATCGTCAACTCGAGTTGACGATTATGCACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_007014.3-2886s21c1
Sequence:CCGGGCGGATGGCAGTCTGGAATAACTCGAGTTATTCCAGACTGCCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007014.x-3403s1c1
Sequence:CCGGGTTTGTTAGGTTTGCCAGGTTCTCGAGAACCTGGCAAACCTAACAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007014.x-1891s1c1
Sequence:CCGGCCTCACCTACTTTCGCTTTATCTCGAGATAAAGCGAAAGTAGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_007014.x-173s1c1
Sequence:CCGGCCCAAGGTGCATAATCGTCAACTCGAGTTGACGATTATGCACCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007014.x-1249s1c1
Sequence:CCGGCCAAAGATTCCTATACCAGTTCTCGAGAACTGGTATAGGAATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007014.x-315s1c1
Sequence:CCGGCGGCACAGAGTCATTTAGATTCTCGAGAATCTAAATGACTCTGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007014
VALIDATED
WWP2 MISSION shRNA shRNA Plasmid DNA
WW domain containing E3 ubiquitin protein ligase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_007014.3-316s21c1
Sequence:CCGGCGGCACAGAGTCATTTAGATTCTCGAGAATCTAAATGACTCTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_007014.3-2299s21c1
Sequence:CCGGTGCGCTACTTTGACGAGAAAGCTCGAGCTTTCTCGTCAAAGTAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_007014.3-1893s21c1
Sequence:CCGGCTCACCTACTTTCGCTTTATACTCGAGTATAAAGCGAAAGTAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007014.3-174s21c1
Sequence:CCGGCCCAAGGTGCATAATCGTCAACTCGAGTTGACGATTATGCACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_007014.3-2886s21c1
Sequence:CCGGGCGGATGGCAGTCTGGAATAACTCGAGTTATTCCAGACTGCCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007014.x-3403s1c1
Sequence:CCGGGTTTGTTAGGTTTGCCAGGTTCTCGAGAACCTGGCAAACCTAACAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007014.x-1891s1c1
Sequence:CCGGCCTCACCTACTTTCGCTTTATCTCGAGATAAAGCGAAAGTAGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_007014.x-173s1c1
Sequence:CCGGCCCAAGGTGCATAATCGTCAACTCGAGTTGACGATTATGCACCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007014.x-1249s1c1
Sequence:CCGGCCAAAGATTCCTATACCAGTTCTCGAGAACTGGTATAGGAATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007014.x-315s1c1
Sequence:CCGGCGGCACAGAGTCATTTAGATTCTCGAGAATCTAAATGACTCTGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007014
VALIDATED
WWP2 MISSION shRNA Lentiviral Transduction Particles
WW domain containing E3 ubiquitin protein ligase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_007014.3-316s21c1
Sequence:CCGGCGGCACAGAGTCATTTAGATTCTCGAGAATCTAAATGACTCTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_007014.3-2299s21c1
Sequence:CCGGTGCGCTACTTTGACGAGAAAGCTCGAGCTTTCTCGTCAAAGTAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_007014.3-1893s21c1
Sequence:CCGGCTCACCTACTTTCGCTTTATACTCGAGTATAAAGCGAAAGTAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007014.3-174s21c1
Sequence:CCGGCCCAAGGTGCATAATCGTCAACTCGAGTTGACGATTATGCACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_007014.3-2886s21c1
Sequence:CCGGGCGGATGGCAGTCTGGAATAACTCGAGTTATTCCAGACTGCCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007014.x-3403s1c1
Sequence:CCGGGTTTGTTAGGTTTGCCAGGTTCTCGAGAACCTGGCAAACCTAACAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_007014.x-1891s1c1
Sequence:CCGGCCTCACCTACTTTCGCTTTATCTCGAGATAAAGCGAAAGTAGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_007014.x-173s1c1
Sequence:CCGGCCCAAGGTGCATAATCGTCAACTCGAGTTGACGATTATGCACCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007014.x-1249s1c1
Sequence:CCGGCCAAAGATTCCTATACCAGTTCTCGAGAACTGGTATAGGAATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007014.x-315s1c1
Sequence:CCGGCGGCACAGAGTCATTTAGATTCTCGAGAATCTAAATGACTCTGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks