EMAIL THIS PAGE TO A FRIEND

WWTR1

WW domain containing transcription regulator 1

Synonyms: TAZ
UniProtKB ID: Q9GZV5, D3DNH7, Q8N3P2, Q9Y3W6
Gene ID:
Mouse(97064) WW domain containing transcription regulator 1
Rat(295062) WW domain containing transcription regulator 1
cow(614786) WW domain containing transcription regulator 1
sheep(101120978) WW domain containing transcription regulator 1
naked mole-rat(101722908) WW domain containing transcription regulator 1
domestic guinea pig(100717864) WW domain containing transcription regulator 1
Zebrafish(568008) WW domain containing transcription regulator 1
Horse(100050661) WW domain containing transcription regulator 1
domestic cat(101100243) WW domain containing transcription regulator 1
dog(609743) WW domain containing transcription regulator 1
chicken(100859902) WW domain containing transcription regulator 1
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
T4077 Anti-TAZ antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
immunohistochemistry, western blot pricing
SAB4300644 Anti-TAZ antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
HPA007415 Anti-WWTR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
AV32540 Anti-WWTR1 antibody produced in rabbit affinity isolated antibody, lyophilized powder bovine, canine, human, mouse, rat
western blot pricing
SAB2102718 Anti-WWTR1 antibody produced in rabbit affinity isolated antibody rat, guinea pig, bovine, mouse, canine, human, rabbit
western blot pricing
AMAB90730 Monoclonal Anti-WWTR1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0371, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1402558 Monoclonal Anti-WWTR1 antibody produced in mouse clone 1F1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
AMAB90729 Monoclonal Anti-WWTR1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0370, purified immunoglobulin, buffered aqueous glycerol solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015472 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015472 Rosetta Predictions human pricing
NM_001024869 Rosetta Predictions rat pricing
NM_133784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124477 predicted 705
2 SASI_Hs01_00124479 predicted 1332
3 SASI_Hs01_00124480 predicted 1263
4 SASI_Hs01_00124482 predicted 355
5 SASI_Hs01_00124483 predicted 1409
6 SASI_Hs01_00124484 predicted 692
7 SASI_Hs02_00347902 predicted 944
8 SASI_Hs01_00124485 predicted 702
9 SASI_Hs02_00347903 predicted 715
10 SASI_Hs02_00347904 predicted 1091
11 SASI_Hs01_00124478 predicted 936
12 SASI_Hs01_00124481 predicted 1116
13 SASI_Hs01_00124486 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120445 predicted 1148
2 SASI_Rn01_00120446 predicted 1170
3 SASI_Rn01_00120448 predicted 1124
4 SASI_Rn02_00202747 predicted 550
5 SASI_Rn01_00120449 predicted 200
6 SASI_Rn01_00120450 predicted 1174
7 SASI_Rn01_00120451 predicted 249
8 SASI_Rn01_00120452 predicted 1111
9 SASI_Rn01_00120453 predicted 1255
10 SASI_Rn01_00120454 predicted 571
11 SASI_Rn01_00120447 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107363 predicted 747
2 SASI_Mm01_00107364 predicted 1381
3 SASI_Mm01_00107365 predicted 1146
4 SASI_Mm01_00107366 predicted 698
5 SASI_Mm01_00107367 predicted 1239
6 SASI_Mm01_00107368 predicted 1005
7 SASI_Mm01_00107369 predicted 666
8 SASI_Mm01_00107370 predicted 887
9 SASI_Mm01_00107371 predicted 704
10 SASI_Mm01_00107372 predicted 1122
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133784
VALIDATED
WWTR1 MISSION shRNA Bacterial Glycerol Stock
WW domain containing transcription regulator 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133784.1-1616s1c1
Sequence:CCGGCCTGCATTTCTGTGGCAGATACTCGAGTATCTGCCACAGAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133784.1-771s1c1
Sequence:CCGGCAGCCGAATCTCGCAATGAATCTCGAGATTCATTGCGAGATTCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133784.1-687s1c1
Sequence:CCGGGTGATGAATCAGCCTCTGAATCTCGAGATTCAGAGGCTGATTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133784.1-1048s1c1
Sequence:CCGGCCATGAGCACAGATATGAGATCTCGAGATCTCATATCTGTGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133784.1-367s1c1
Sequence:CCGGCCTTCTTTAAGGAGCCCGATTCTCGAGAATCGGGCTCCTTAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133784.2-752s21c1
Sequence:CCGGGTGATGAATCAGCCTCTGAATCTCGAGATTCAGAGGCTGATTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133784.2-836s21c1
Sequence:CCGGCAGCCGAATCTCGCAATGAATCTCGAGATTCATTGCGAGATTCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133784.2-1113s21c1
Sequence:CCGGCCATGAGCACAGATATGAGATCTCGAGATCTCATATCTGTGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133784.2-432s21c1
Sequence:CCGGCCTTCTTTAAGGAGCCCGATTCTCGAGAATCGGGCTCCTTAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133784
VALIDATED
WWTR1 MISSION shRNA shRNA Plasmid DNA
WW domain containing transcription regulator 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133784.1-1616s1c1
Sequence:CCGGCCTGCATTTCTGTGGCAGATACTCGAGTATCTGCCACAGAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133784.1-771s1c1
Sequence:CCGGCAGCCGAATCTCGCAATGAATCTCGAGATTCATTGCGAGATTCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133784.1-687s1c1
Sequence:CCGGGTGATGAATCAGCCTCTGAATCTCGAGATTCAGAGGCTGATTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133784.1-1048s1c1
Sequence:CCGGCCATGAGCACAGATATGAGATCTCGAGATCTCATATCTGTGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133784.1-367s1c1
Sequence:CCGGCCTTCTTTAAGGAGCCCGATTCTCGAGAATCGGGCTCCTTAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133784.2-752s21c1
Sequence:CCGGGTGATGAATCAGCCTCTGAATCTCGAGATTCAGAGGCTGATTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133784.2-836s21c1
Sequence:CCGGCAGCCGAATCTCGCAATGAATCTCGAGATTCATTGCGAGATTCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133784.2-1113s21c1
Sequence:CCGGCCATGAGCACAGATATGAGATCTCGAGATCTCATATCTGTGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133784.2-432s21c1
Sequence:CCGGCCTTCTTTAAGGAGCCCGATTCTCGAGAATCGGGCTCCTTAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133784
VALIDATED
WWTR1 MISSION shRNA Lentiviral Transduction Particles
WW domain containing transcription regulator 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133784.1-1616s1c1
Sequence:CCGGCCTGCATTTCTGTGGCAGATACTCGAGTATCTGCCACAGAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133784.1-771s1c1
Sequence:CCGGCAGCCGAATCTCGCAATGAATCTCGAGATTCATTGCGAGATTCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133784.1-687s1c1
Sequence:CCGGGTGATGAATCAGCCTCTGAATCTCGAGATTCAGAGGCTGATTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133784.1-1048s1c1
Sequence:CCGGCCATGAGCACAGATATGAGATCTCGAGATCTCATATCTGTGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133784.1-367s1c1
Sequence:CCGGCCTTCTTTAAGGAGCCCGATTCTCGAGAATCGGGCTCCTTAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133784.2-752s21c1
Sequence:CCGGGTGATGAATCAGCCTCTGAATCTCGAGATTCAGAGGCTGATTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133784.2-836s21c1
Sequence:CCGGCAGCCGAATCTCGCAATGAATCTCGAGATTCATTGCGAGATTCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133784.2-1113s21c1
Sequence:CCGGCCATGAGCACAGATATGAGATCTCGAGATCTCATATCTGTGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133784.2-432s21c1
Sequence:CCGGCCTTCTTTAAGGAGCCCGATTCTCGAGAATCGGGCTCCTTAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015472
VALIDATED
WWTR1 MISSION shRNA Bacterial Glycerol Stock
WW domain containing transcription regulator 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015472.3-706s1c1
Sequence:CCGGGCGATGAATCAGCCTCTGAATCTCGAGATTCAGAGGCTGATTCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015472.3-1327s1c1
Sequence:CCGGCCAGGAACAAACGTTGACTTACTCGAGTAAGTCAACGTTTGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015472.3-375s1c1
Sequence:CCGGCCTGCCGGAGTCTTTCTTTAACTCGAGTTAAAGAAAGACTCCGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015472.3-1416s1c1
Sequence:CCGGGCCCTTTCTAACCTGGCTGTACTCGAGTACAGCCAGGTTAGAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015472.3-790s1c1
Sequence:CCGGCAGCCAAATCTCGTGATGAATCTCGAGATTCATCACGAGATTTGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015472.3-1744s21c1
Sequence:CCGGTAAGCTTTATGGGTGTTAATTCTCGAGAATTAACACCCATAAAGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015472.3-790s21c1
Sequence:CCGGCAGCCAAATCTCGTGATGAATCTCGAGATTCATCACGAGATTTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015472.3-706s21c1
Sequence:CCGGGCGATGAATCAGCCTCTGAATCTCGAGATTCAGAGGCTGATTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015472.3-1327s21c1
Sequence:CCGGCCAGGAACAAACGTTGACTTACTCGAGTAAGTCAACGTTTGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015472.3-1657s21c1
Sequence:CCGGGCGTTCTTGTGACAGATTATACTCGAGTATAATCTGTCACAAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015472
VALIDATED
WWTR1 MISSION shRNA shRNA Plasmid DNA
WW domain containing transcription regulator 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015472.3-706s1c1
Sequence:CCGGGCGATGAATCAGCCTCTGAATCTCGAGATTCAGAGGCTGATTCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015472.3-1327s1c1
Sequence:CCGGCCAGGAACAAACGTTGACTTACTCGAGTAAGTCAACGTTTGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015472.3-375s1c1
Sequence:CCGGCCTGCCGGAGTCTTTCTTTAACTCGAGTTAAAGAAAGACTCCGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015472.3-1416s1c1
Sequence:CCGGGCCCTTTCTAACCTGGCTGTACTCGAGTACAGCCAGGTTAGAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015472.3-790s1c1
Sequence:CCGGCAGCCAAATCTCGTGATGAATCTCGAGATTCATCACGAGATTTGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015472.3-1744s21c1
Sequence:CCGGTAAGCTTTATGGGTGTTAATTCTCGAGAATTAACACCCATAAAGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015472.3-790s21c1
Sequence:CCGGCAGCCAAATCTCGTGATGAATCTCGAGATTCATCACGAGATTTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015472.3-706s21c1
Sequence:CCGGGCGATGAATCAGCCTCTGAATCTCGAGATTCAGAGGCTGATTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015472.3-1327s21c1
Sequence:CCGGCCAGGAACAAACGTTGACTTACTCGAGTAAGTCAACGTTTGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015472.3-1657s21c1
Sequence:CCGGGCGTTCTTGTGACAGATTATACTCGAGTATAATCTGTCACAAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015472
VALIDATED
WWTR1 MISSION shRNA Lentiviral Transduction Particles
WW domain containing transcription regulator 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015472.3-706s1c1
Sequence:CCGGGCGATGAATCAGCCTCTGAATCTCGAGATTCAGAGGCTGATTCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015472.3-1327s1c1
Sequence:CCGGCCAGGAACAAACGTTGACTTACTCGAGTAAGTCAACGTTTGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015472.3-375s1c1
Sequence:CCGGCCTGCCGGAGTCTTTCTTTAACTCGAGTTAAAGAAAGACTCCGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015472.3-1416s1c1
Sequence:CCGGGCCCTTTCTAACCTGGCTGTACTCGAGTACAGCCAGGTTAGAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015472.3-790s1c1
Sequence:CCGGCAGCCAAATCTCGTGATGAATCTCGAGATTCATCACGAGATTTGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_015472.3-1744s21c1
Sequence:CCGGTAAGCTTTATGGGTGTTAATTCTCGAGAATTAACACCCATAAAGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015472.3-790s21c1
Sequence:CCGGCAGCCAAATCTCGTGATGAATCTCGAGATTCATCACGAGATTTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015472.3-706s21c1
Sequence:CCGGGCGATGAATCAGCCTCTGAATCTCGAGATTCAGAGGCTGATTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015472.3-1327s21c1
Sequence:CCGGCCAGGAACAAACGTTGACTTACTCGAGTAAGTCAACGTTTGTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015472.3-1657s21c1
Sequence:CCGGGCGTTCTTGTGACAGATTATACTCGAGTATAATCTGTCACAAGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks