EMAIL THIS PAGE TO A FRIEND

XAB2

XPA binding protein 2

Synonyms: HCNP HCRN NTC90 SYF1
UniProtKB ID: Q9HCS7, Q8TET6, Q96HB0, Q96IW0, Q9NRG6, Q9ULP3
Gene ID:
Mouse(67439) XPA binding protein 2
Rat(245976) XPA binding protein 2
Zebrafish(387600) XPA binding protein 2
dog(484995) XPA binding protein 2
domestic cat(101097459) XPA binding protein 2
Horse(100060674) XPA binding protein 2
cow(528991) XPA binding protein 2
sheep(101122353) XPA binding protein 2
domestic guinea pig(100719499) XPA binding protein 2
naked mole-rat(101700264) XPA binding protein 2
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020196 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026156 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026156 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026156 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020196 Rosetta Predictions human pricing
NM_139109 Rosetta Predictions rat pricing
NM_026156 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205835 predicted 517
2 SASI_Hs01_00205836 predicted 2009
3 SASI_Hs01_00205837 predicted 1967
4 SASI_Hs01_00205838 predicted 347
5 SASI_Hs01_00205839 predicted 1981
6 SASI_Hs01_00205840 predicted 931
7 SASI_Hs01_00205842 predicted 1453
8 SASI_Hs01_00205843 predicted 1204
9 SASI_Hs01_00205844 predicted 290
10 SASI_Hs02_00353128 predicted 870
11 SASI_Hs01_00205841 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039172 predicted 1388
2 SASI_Rn01_00039173 predicted 1603
3 SASI_Rn01_00039174 predicted 1156
4 SASI_Rn01_00039176 predicted 1557
5 SASI_Rn01_00039177 predicted 198
6 SASI_Rn01_00039178 predicted 324
7 SASI_Rn01_00039179 predicted 946
8 SASI_Rn01_00039180 predicted 671
9 SASI_Rn01_00039181 predicted 311
10 SASI_Rn02_00268487 predicted 743
11 SASI_Rn01_00039175 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181884 predicted 617
2 SASI_Mm01_00181885 predicted 389
3 SASI_Mm01_00181886 predicted 1129
4 SASI_Mm01_00181887 predicted 788
5 SASI_Mm01_00181888 predicted 636
6 SASI_Mm01_00181889 predicted 1416
7 SASI_Mm01_00181890 predicted 1656
8 SASI_Mm01_00181891 predicted 716
9 SASI_Mm01_00181892 predicted 649
10 SASI_Mm01_00181893 predicted 356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020196
VALIDATED
XAB2 MISSION shRNA Bacterial Glycerol Stock
XPA binding protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020196.2-176s21c1
Sequence:CCGGGCCCAGGCTCAATCAGCTATACTCGAGTATAGCTGATTGAGCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020196.2-451s21c1
Sequence:CCGGTCACGCAGCACTCTCGAATTTCTCGAGAAATTCGAGAGTGCTGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020196.2-642s21c1
Sequence:CCGGGACGAGCGTTTCGTGTCTAAGCTCGAGCTTAGACACGAAACGCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020196.2-353s21c1
Sequence:CCGGGCCTCGTCTGTGGCTAGATTACTCGAGTAATCTAGCCACAGACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020196.2-1579s21c1
Sequence:CCGGCCCAGATCGTCATCAACTATGCTCGAGCATAGTTGATGACGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_020196.2-114s1c1
Sequence:CCGGCGGAACCAATTCTCTGTCAAACTCGAGTTTGACAGAGAATTGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_020196.2-1907s1c1
Sequence:CCGGGCAGTATGACATGTTCAACATCTCGAGATGTTGAACATGTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_020196.2-1709s1c1
Sequence:CCGGGACCAAATTCATTGCCCGCTACTCGAGTAGCGGGCAATGAATTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020196.2-2182s1c1
Sequence:CCGGCCATCAAGGAAATGCTGCGTACTCGAGTACGCAGCATTTCCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_020196.2-140s1c1
Sequence:CCGGGCTTCGCTACATCGAGTTCAACTCGAGTTGAACTCGATGTAGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020196
VALIDATED
XAB2 MISSION shRNA shRNA Plasmid DNA
XPA binding protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020196.2-176s21c1
Sequence:CCGGGCCCAGGCTCAATCAGCTATACTCGAGTATAGCTGATTGAGCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020196.2-451s21c1
Sequence:CCGGTCACGCAGCACTCTCGAATTTCTCGAGAAATTCGAGAGTGCTGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020196.2-642s21c1
Sequence:CCGGGACGAGCGTTTCGTGTCTAAGCTCGAGCTTAGACACGAAACGCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020196.2-353s21c1
Sequence:CCGGGCCTCGTCTGTGGCTAGATTACTCGAGTAATCTAGCCACAGACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020196.2-1579s21c1
Sequence:CCGGCCCAGATCGTCATCAACTATGCTCGAGCATAGTTGATGACGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_020196.2-114s1c1
Sequence:CCGGCGGAACCAATTCTCTGTCAAACTCGAGTTTGACAGAGAATTGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_020196.2-1907s1c1
Sequence:CCGGGCAGTATGACATGTTCAACATCTCGAGATGTTGAACATGTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_020196.2-1709s1c1
Sequence:CCGGGACCAAATTCATTGCCCGCTACTCGAGTAGCGGGCAATGAATTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020196.2-2182s1c1
Sequence:CCGGCCATCAAGGAAATGCTGCGTACTCGAGTACGCAGCATTTCCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_020196.2-140s1c1
Sequence:CCGGGCTTCGCTACATCGAGTTCAACTCGAGTTGAACTCGATGTAGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020196
VALIDATED
XAB2 MISSION shRNA Lentiviral Transduction Particles
XPA binding protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020196.2-176s21c1
Sequence:CCGGGCCCAGGCTCAATCAGCTATACTCGAGTATAGCTGATTGAGCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020196.2-451s21c1
Sequence:CCGGTCACGCAGCACTCTCGAATTTCTCGAGAAATTCGAGAGTGCTGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020196.2-642s21c1
Sequence:CCGGGACGAGCGTTTCGTGTCTAAGCTCGAGCTTAGACACGAAACGCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020196.2-353s21c1
Sequence:CCGGGCCTCGTCTGTGGCTAGATTACTCGAGTAATCTAGCCACAGACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020196.2-1579s21c1
Sequence:CCGGCCCAGATCGTCATCAACTATGCTCGAGCATAGTTGATGACGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_020196.2-114s1c1
Sequence:CCGGCGGAACCAATTCTCTGTCAAACTCGAGTTTGACAGAGAATTGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_020196.2-1907s1c1
Sequence:CCGGGCAGTATGACATGTTCAACATCTCGAGATGTTGAACATGTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_020196.2-1709s1c1
Sequence:CCGGGACCAAATTCATTGCCCGCTACTCGAGTAGCGGGCAATGAATTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020196.2-2182s1c1
Sequence:CCGGCCATCAAGGAAATGCTGCGTACTCGAGTACGCAGCATTTCCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_020196.2-140s1c1
Sequence:CCGGGCTTCGCTACATCGAGTTCAACTCGAGTTGAACTCGATGTAGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026156
VALIDATED
XAB2 MISSION shRNA Bacterial Glycerol Stock
XPA binding protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026156.2-1440s21c1
Sequence:CCGGACCTGTGCAGAACCGTGTATACTCGAGTATACACGGTTCTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026156.2-2040s21c1
Sequence:CCGGGGAGTGCAAGCTCGGTGAAATCTCGAGATTTCACCGAGCTTGCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026156.2-1359s21c1
Sequence:GTACCGGGAATTACGATGAGGCCTTAAACTCGAGTTTAAGGCCTCATCGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026156.2-1565s21c1
Sequence:CCGGCCACGCCACAGATCGTTATTACTCGAGTAATAACGATCTGTGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026156.2-644s21c1
Sequence:CCGGTTGTATCCAAGGCTGGTAAATCTCGAGATTTACCAGCCTTGGATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026156.1-1442s1c1
Sequence:CCGGCCTGTGCAGAACCGTGTATATCTCGAGATATACACGGTTCTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026156.1-1566s1c1
Sequence:CCGGCCACGCCACAGATCGTTATTACTCGAGTAATAACGATCTGTGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026156.1-134s1c1
Sequence:CCGGCTCCGCTACATCGAGTTCAAACTCGAGTTTGAACTCGATGTAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026156.1-1579s1c1
Sequence:CCGGCGTTATTAACTATGCCATGTTCTCGAGAACATGGCATAGTTAATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026156.1-556s1c1
Sequence:CCGGCGCTGAGGAATACATCGAGTACTCGAGTACTCGATGTATTCCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026156
VALIDATED
XAB2 MISSION shRNA shRNA Plasmid DNA
XPA binding protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026156.2-1440s21c1
Sequence:CCGGACCTGTGCAGAACCGTGTATACTCGAGTATACACGGTTCTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026156.2-2040s21c1
Sequence:CCGGGGAGTGCAAGCTCGGTGAAATCTCGAGATTTCACCGAGCTTGCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026156.2-1359s21c1
Sequence:GTACCGGGAATTACGATGAGGCCTTAAACTCGAGTTTAAGGCCTCATCGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026156.2-1565s21c1
Sequence:CCGGCCACGCCACAGATCGTTATTACTCGAGTAATAACGATCTGTGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026156.2-644s21c1
Sequence:CCGGTTGTATCCAAGGCTGGTAAATCTCGAGATTTACCAGCCTTGGATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026156.1-1442s1c1
Sequence:CCGGCCTGTGCAGAACCGTGTATATCTCGAGATATACACGGTTCTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026156.1-1566s1c1
Sequence:CCGGCCACGCCACAGATCGTTATTACTCGAGTAATAACGATCTGTGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026156.1-134s1c1
Sequence:CCGGCTCCGCTACATCGAGTTCAAACTCGAGTTTGAACTCGATGTAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026156.1-1579s1c1
Sequence:CCGGCGTTATTAACTATGCCATGTTCTCGAGAACATGGCATAGTTAATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026156.1-556s1c1
Sequence:CCGGCGCTGAGGAATACATCGAGTACTCGAGTACTCGATGTATTCCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026156
VALIDATED
XAB2 MISSION shRNA Lentiviral Transduction Particles
XPA binding protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026156.2-1440s21c1
Sequence:CCGGACCTGTGCAGAACCGTGTATACTCGAGTATACACGGTTCTGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026156.2-2040s21c1
Sequence:CCGGGGAGTGCAAGCTCGGTGAAATCTCGAGATTTCACCGAGCTTGCACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026156.2-1359s21c1
Sequence:GTACCGGGAATTACGATGAGGCCTTAAACTCGAGTTTAAGGCCTCATCGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026156.2-1565s21c1
Sequence:CCGGCCACGCCACAGATCGTTATTACTCGAGTAATAACGATCTGTGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026156.2-644s21c1
Sequence:CCGGTTGTATCCAAGGCTGGTAAATCTCGAGATTTACCAGCCTTGGATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026156.1-1442s1c1
Sequence:CCGGCCTGTGCAGAACCGTGTATATCTCGAGATATACACGGTTCTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026156.1-1566s1c1
Sequence:CCGGCCACGCCACAGATCGTTATTACTCGAGTAATAACGATCTGTGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026156.1-134s1c1
Sequence:CCGGCTCCGCTACATCGAGTTCAAACTCGAGTTTGAACTCGATGTAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026156.1-1579s1c1
Sequence:CCGGCGTTATTAACTATGCCATGTTCTCGAGAACATGGCATAGTTAATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026156.1-556s1c1
Sequence:CCGGCGCTGAGGAATACATCGAGTACTCGAGTACTCGATGTATTCCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks