EMAIL THIS PAGE TO A FRIEND

XAF1

XIAP associated factor 1

Synonyms: BIRC4BP HSXIAPAF1 XIAPAF1
Gene ID:
Human(54739) Summary: This gene encodes a protein which binds to and counteracts the inhibitory effect of a member of the IAP (inhibitor of apoptosis) protein family. IAP proteins bind to and inhibit caspases which are activated during apoptosis. The proportion of IAPs and proteins which interfere with their activity, such as the encoded protein, affect the progress of the apoptosis signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(327959) XIAP associated factor 1
Rat(679600) XIAP associated factor-1
naked mole-rat(101719296) XIAP associated factor 1
domestic guinea pig(100728519) XIAP associated factor 1
cow(509740) XIAP associated factor 1
sheep(101103655) XIAP associated factor 1
chicken(417677) XIAP associated factor 1
dog(606957) XIAP associated factor 1
139 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS3207 Anti-XAF-1 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS3409 Anti-XAF-1 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1101900 Anti-XAF1 (288-301) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1407566 Anti-XAF1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2900401 Anti-XAF1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB2105130 Anti-XAF1 antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA057302 Anti-XAF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2900293 Anti-XIAP Associated Factor-1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1402592 Monoclonal Anti-XAF1, (C-terminal) antibody produced in mouse clone 3E5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017523 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017523 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017523 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001037713 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037713 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037713 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017523 Rosetta Predictions human pricing
NM_199139 Rosetta Predictions human pricing
XM_001053682 Rosetta Predictions rat pricing
NM_001037713 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056916 predicted 724
2 SASI_Hs01_00056917 predicted 1020
3 SASI_Hs01_00056918 predicted 861
4 SASI_Hs01_00056919 predicted 737
5 SASI_Hs01_00056920 predicted 871
6 SASI_Hs01_00056921 predicted 677
7 SASI_Hs01_00056922 predicted 1008
8 SASI_Hs02_00350144 predicted 694
9 SASI_Hs02_00350145 predicted 731
10 SASI_Hs02_00350146 predicted 1003
11 SASI_Hs01_00056913 predicted 1029
12 SASI_Hs01_00056914 predicted 710
13 SASI_Hs01_00056915 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028614 predicted 671
2 SASI_Hs01_00028615 predicted 956
3 SASI_Hs01_00028616 predicted 807
4 SASI_Hs01_00028617 predicted 679
5 SASI_Hs01_00028618 predicted 821
6 SASI_Hs01_00028619 predicted 612
7 SASI_Hs01_00028620 predicted 951
8 SASI_Hs02_00372582 predicted 640
9 SASI_Hs02_00372583 predicted 679
10 SASI_Hs02_00372584 predicted 947
11 SASI_Hs01_00028611 predicted 977
12 SASI_Hs01_00028612 predicted 654
13 SASI_Hs01_00028613 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273180 predicted 314
2 SASI_Rn02_00273181 predicted 469
3 SASI_Rn02_00273182 predicted 447
4 SASI_Rn02_00273183 predicted 437
5 SASI_Rn02_00273184 predicted 338
6 SASI_Rn02_00273185 predicted 362
7 SASI_Rn02_00273186 predicted 592
8 SASI_Rn02_00273187 predicted 259
9 SASI_Rn02_00273188 predicted 544
10 SASI_Rn02_00273189 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289330 predicted 602
2 SASI_Mm02_00289331 predicted 480
3 SASI_Mm01_00086219 predicted 375
4 SASI_Mm02_00289332 predicted 565
5 SASI_Mm02_00289333 predicted 538
6 SASI_Mm01_00086222 predicted 349
7 SASI_Mm02_00289334 predicted 787
8 SASI_Mm02_00289335 predicted 526
9 SASI_Mm02_00289336 predicted 747
10 SASI_Mm02_00289337 predicted 763
11 SASI_Mm01_00086220 predicted 417
12 SASI_Mm01_00086221 predicted 507
13 SASI_Mm01_00086223 predicted 581
14 SASI_Mm01_00086224 predicted 762
15 SASI_Mm01_00086225 predicted 635
16 SASI_Mm01_00086226 predicted 432
17 SASI_Mm01_00086227 predicted 470
18 SASI_Mm01_00086228 predicted 313
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017523
XAF1 MISSION shRNA Bacterial Glycerol Stock
XIAP associated factor 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017523.2-2335s1c1
Sequence:CCGGGCTAGCCATATGCAGAGGATTCTCGAGAATCCTCTGCATATGGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017523.2-919s1c1
Sequence:CCGGGTTCATCAAAGAAAGCACCAACTCGAGTTGGTGCTTTCTTTGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017523.2-684s1c1
Sequence:CCGGGAAAGGGAAATCTACTGTCATCTCGAGATGACAGTAGATTTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017523.2-1037s1c1
Sequence:CCGGGAGATGTTCTCAGTGTGGCATCTCGAGATGCCACACTGAGAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017523.2-1070s21c1
Sequence:CCGGGCCGATCCTAAATCAACATCACTCGAGTGATGTTGATTTAGGATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017523.2-1296s21c1
Sequence:CCGGACTCACGTATCATCTCAATAGCTCGAGCTATTGAGATGATACGTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017523
XAF1 MISSION shRNA shRNA Plasmid DNA
XIAP associated factor 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017523.2-2335s1c1
Sequence:CCGGGCTAGCCATATGCAGAGGATTCTCGAGAATCCTCTGCATATGGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017523.2-919s1c1
Sequence:CCGGGTTCATCAAAGAAAGCACCAACTCGAGTTGGTGCTTTCTTTGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017523.2-684s1c1
Sequence:CCGGGAAAGGGAAATCTACTGTCATCTCGAGATGACAGTAGATTTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017523.2-1037s1c1
Sequence:CCGGGAGATGTTCTCAGTGTGGCATCTCGAGATGCCACACTGAGAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017523.2-1070s21c1
Sequence:CCGGGCCGATCCTAAATCAACATCACTCGAGTGATGTTGATTTAGGATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017523.2-1296s21c1
Sequence:CCGGACTCACGTATCATCTCAATAGCTCGAGCTATTGAGATGATACGTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017523
XAF1 MISSION shRNA Lentiviral Transduction Particles
XIAP associated factor 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017523.2-2335s1c1
Sequence:CCGGGCTAGCCATATGCAGAGGATTCTCGAGAATCCTCTGCATATGGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017523.2-919s1c1
Sequence:CCGGGTTCATCAAAGAAAGCACCAACTCGAGTTGGTGCTTTCTTTGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017523.2-684s1c1
Sequence:CCGGGAAAGGGAAATCTACTGTCATCTCGAGATGACAGTAGATTTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017523.2-1037s1c1
Sequence:CCGGGAGATGTTCTCAGTGTGGCATCTCGAGATGCCACACTGAGAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017523.2-1070s21c1
Sequence:CCGGGCCGATCCTAAATCAACATCACTCGAGTGATGTTGATTTAGGATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017523.2-1296s21c1
Sequence:CCGGACTCACGTATCATCTCAATAGCTCGAGCTATTGAGATGATACGTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037713
VALIDATED
XAF1 MISSION shRNA Bacterial Glycerol Stock
XIAP associated factor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037713.3-790s21c1
Sequence:CCGGACTTCCCTTGCCCATTCTAAACTCGAGTTTAGAATGGGCAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037713.3-563s21c1
Sequence:CCGGCCTTCAACCCTTGCATTTATGCTCGAGCATAAATGCAAGGGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037713.3-768s21c1
Sequence:CCGGACTGTTGTCAGTGCCGAATTTCTCGAGAAATTCGGCACTGACAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037713.3-1508s21c1
Sequence:CCGGCATGCTTATCCAGGTCTTATGCTCGAGCATAAGACCTGGATAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037713.3-537s21c1
Sequence:CCGGTTCGGGATGAAAGTATAATAGCTCGAGCTATTATACTTTCATCCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037713
VALIDATED
XAF1 MISSION shRNA shRNA Plasmid DNA
XIAP associated factor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037713.3-790s21c1
Sequence:CCGGACTTCCCTTGCCCATTCTAAACTCGAGTTTAGAATGGGCAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037713.3-563s21c1
Sequence:CCGGCCTTCAACCCTTGCATTTATGCTCGAGCATAAATGCAAGGGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037713.3-768s21c1
Sequence:CCGGACTGTTGTCAGTGCCGAATTTCTCGAGAAATTCGGCACTGACAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037713.3-1508s21c1
Sequence:CCGGCATGCTTATCCAGGTCTTATGCTCGAGCATAAGACCTGGATAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037713.3-537s21c1
Sequence:CCGGTTCGGGATGAAAGTATAATAGCTCGAGCTATTATACTTTCATCCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037713
VALIDATED
XAF1 MISSION shRNA Lentiviral Transduction Particles
XIAP associated factor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037713.3-790s21c1
Sequence:CCGGACTTCCCTTGCCCATTCTAAACTCGAGTTTAGAATGGGCAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037713.3-563s21c1
Sequence:CCGGCCTTCAACCCTTGCATTTATGCTCGAGCATAAATGCAAGGGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001037713.3-768s21c1
Sequence:CCGGACTGTTGTCAGTGCCGAATTTCTCGAGAAATTCGGCACTGACAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037713.3-1508s21c1
Sequence:CCGGCATGCTTATCCAGGTCTTATGCTCGAGCATAAGACCTGGATAAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037713.3-537s21c1
Sequence:CCGGTTCGGGATGAAAGTATAATAGCTCGAGCTATTATACTTTCATCCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks