EMAIL THIS PAGE TO A FRIEND

XAGE1A

X antigen family, member 1A

Synonyms: CT12.1 CT12.1A CTP9 GAGED2 XAGE1
Species: Human XAGE1A(653219)
Gene ID:
Human(653219) Summary: This gene is a member of the XAGE subfamily, which belongs to the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is strongly expressed in Ewing's sarcoma, alveolar rhabdomyosarcoma and normal testis. The protein encoded by this gene contains a nuclear localization signal and shares a sequence similarity with other GAGE/PAGE proteins. Because of the expression pattern and the sequence similarity, this protein also belongs to a family of CT (cancer-testis) antigens. Alternative splicing of this gene, in addition to alternative transcription start sites, results in multiple transcript variants. [provided by RefSeq, Jan 2010]
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001097591 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001097591 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001097591 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001097591 Rosetta Predictions human pricing
NM_001097592 Rosetta Predictions human pricing
NM_001097593 Rosetta Predictions human pricing
XM_927237 Rosetta Predictions human pricing
XM_931959 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318260 predicted 539
2 SASI_Hs02_00318261 predicted 388
3 SASI_Hs02_00318262 predicted 380
4 SASI_Hs02_00318263 predicted 230
5 SASI_Hs02_00318264 predicted 522
6 SASI_Hs02_00318265 predicted 243
7 SASI_Hs02_00318266 predicted 516
8 SASI_Hs02_00318267 predicted 218
9 SASI_Hs02_00318268 predicted 221
10 SASI_Hs02_00318269 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318270 predicted 380
2 SASI_Hs02_00318271 predicted 332
3 SASI_Hs02_00318272 predicted 369
4 SASI_Hs02_00318273 predicted 215
5 SASI_Hs02_00318274 predicted 261
6 SASI_Hs02_00318275 predicted 364
7 SASI_Hs02_00318276 predicted 370
8 SASI_Hs02_00318277 predicted 195
9 SASI_Hs02_00318278 predicted 324
10 SASI_Hs02_00318279 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318280 predicted 281
2 SASI_Hs02_00318281 predicted 235
3 SASI_Hs02_00318282 predicted 172
4 SASI_Hs02_00318283 predicted 165
5 SASI_Hs02_00318284 predicted 278
6 SASI_Hs02_00318285 predicted 210
7 SASI_Hs02_00318286 predicted 213
8 SASI_Hs02_00318287 predicted 339
9 SASI_Hs02_00318288 predicted 284
10 SASI_Hs02_00318289 predicted 170
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277033 predicted 538
2 SASI_Hs01_00277034 predicted 384
3 SASI_Hs01_00277035 predicted 382
4 SASI_Hs01_00277036 predicted 229
5 SASI_Hs01_00277037 predicted 518
6 SASI_Hs01_00277038 predicted 342
7 SASI_Hs01_00277039 predicted 246
8 SASI_Hs01_00277040 predicted 219
9 SASI_Hs01_00277041 predicted 212
10 SASI_Hs01_00277042 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281105 predicted 375
2 SASI_Hs01_00281106 predicted 376
3 SASI_Hs01_00281107 predicted 261
4 SASI_Hs01_00281108 predicted 213
5 SASI_Hs01_00281109 predicted 254
6 SASI_Hs01_00281110 predicted 355
7 SASI_Hs01_00281111 predicted 362
8 SASI_Hs01_00281112 predicted 373
9 SASI_Hs01_00281113 predicted 220
10 SASI_Hs01_00281114 predicted 360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001097591
XAGE1A MISSION shRNA Bacterial Glycerol Stock
X antigen family, member 1A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097591.1-515s21c1
Sequence:CCGGAGATCAGGATACAGCTGAGATCTCGAGATCTCAGCTGTATCCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097591.1-233s21c1
Sequence:CCGGCTTGTCTCGTCACGGCCATAACTCGAGTTATGGCCGTGACGAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097591.1-396s21c1
Sequence:CCGGGCGACACACACAAACACAGAACTCGAGTTCTGTGTTTGTGTGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097591.1-473s21c1
Sequence:CCGGAGCTGAAAGTCGGGATCCTACCTCGAGGTAGGATCCCGACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097591.1-562s21c1
Sequence:CCGGTGCAAGAGCTGCATCAGTCAACTCGAGTTGACTGATGCAGCTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001097591
XAGE1A MISSION shRNA shRNA Plasmid DNA
X antigen family, member 1A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097591.1-515s21c1
Sequence:CCGGAGATCAGGATACAGCTGAGATCTCGAGATCTCAGCTGTATCCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097591.1-233s21c1
Sequence:CCGGCTTGTCTCGTCACGGCCATAACTCGAGTTATGGCCGTGACGAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097591.1-396s21c1
Sequence:CCGGGCGACACACACAAACACAGAACTCGAGTTCTGTGTTTGTGTGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097591.1-473s21c1
Sequence:CCGGAGCTGAAAGTCGGGATCCTACCTCGAGGTAGGATCCCGACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097591.1-562s21c1
Sequence:CCGGTGCAAGAGCTGCATCAGTCAACTCGAGTTGACTGATGCAGCTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001097591
XAGE1A MISSION shRNA Lentiviral Transduction Particles
X antigen family, member 1A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097591.1-515s21c1
Sequence:CCGGAGATCAGGATACAGCTGAGATCTCGAGATCTCAGCTGTATCCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097591.1-233s21c1
Sequence:CCGGCTTGTCTCGTCACGGCCATAACTCGAGTTATGGCCGTGACGAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097591.1-396s21c1
Sequence:CCGGGCGACACACACAAACACAGAACTCGAGTTCTGTGTTTGTGTGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097591.1-473s21c1
Sequence:CCGGAGCTGAAAGTCGGGATCCTACCTCGAGGTAGGATCCCGACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097591.1-562s21c1
Sequence:CCGGTGCAAGAGCTGCATCAGTCAACTCGAGTTGACTGATGCAGCTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks