EMAIL THIS PAGE TO A FRIEND

XAGE1B

X antigen family, member 1B

Synonyms: CT12.1 CT12.1B CTP9 GAGED2 XAGE-1
Species: Human XAGE1B(653220)
Gene ID:
Human(653220) Summary: This gene is a member of the XAGE subfamily, which belongs to the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is strongly expressed in Ewing's sarcoma, alveolar rhabdomyosarcoma and normal testis. The protein encoded by this gene contains a nuclear localization signal and shares a sequence similarity with other GAGE/PAGE proteins. Because of the expression pattern and the sequence similarity, this protein also belongs to a family of CT (cancer-testis) antigens. Alternative splicing of this gene, in addition to alternative transcription start sites, results in multiple transcript variants. [provided by RefSeq, Jan 2010]
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001097594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001097594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001097594 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001097594 Rosetta Predictions human pricing
NM_001097595 Rosetta Predictions human pricing
NM_001097596 Rosetta Predictions human pricing
XM_927252 Rosetta Predictions human pricing
XM_931969 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318290 predicted 383
2 SASI_Hs02_00318291 predicted 329
3 SASI_Hs02_00318292 predicted 371
4 SASI_Hs02_00318293 predicted 216
5 SASI_Hs02_00318294 predicted 262
6 SASI_Hs02_00318295 predicted 361
7 SASI_Hs02_00318296 predicted 369
8 SASI_Hs02_00318297 predicted 196
9 SASI_Hs02_00318298 predicted 324
10 SASI_Hs02_00318299 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318300 predicted 540
2 SASI_Hs02_00318301 predicted 388
3 SASI_Hs02_00318302 predicted 388
4 SASI_Hs02_00318303 predicted 230
5 SASI_Hs02_00318304 predicted 521
6 SASI_Hs02_00318305 predicted 246
7 SASI_Hs02_00318306 predicted 512
8 SASI_Hs02_00318307 predicted 223
9 SASI_Hs02_00318308 predicted 215
10 SASI_Hs02_00318309 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318310 predicted 276
2 SASI_Hs02_00318311 predicted 239
3 SASI_Hs02_00318312 predicted 179
4 SASI_Hs02_00318313 predicted 165
5 SASI_Hs02_00318314 predicted 284
6 SASI_Hs02_00318315 predicted 209
7 SASI_Hs02_00318316 predicted 210
8 SASI_Hs02_00318317 predicted 346
9 SASI_Hs02_00318318 predicted 285
10 SASI_Hs02_00318319 predicted 174
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260487 predicted 545
2 SASI_Hs01_00260488 predicted 381
3 SASI_Hs01_00260489 predicted 387
4 SASI_Hs01_00260490 predicted 227
5 SASI_Hs01_00260491 predicted 520
6 SASI_Hs01_00260492 predicted 339
7 SASI_Hs01_00260493 predicted 239
8 SASI_Hs01_00260494 predicted 216
9 SASI_Hs01_00260495 predicted 215
10 SASI_Hs01_00260496 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261898 predicted 377
2 SASI_Hs01_00261899 predicted 370
3 SASI_Hs01_00261900 predicted 259
4 SASI_Hs01_00261901 predicted 216
5 SASI_Hs01_00261902 predicted 256
6 SASI_Hs01_00261903 predicted 357
7 SASI_Hs01_00261904 predicted 361
8 SASI_Hs01_00261905 predicted 374
9 SASI_Hs01_00261906 predicted 223
10 SASI_Hs01_00261907 predicted 362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001097594
XAGE1B MISSION shRNA Bacterial Glycerol Stock
X antigen family, member 1B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-353s21c1
Sequence:CCGGATCAGGATACAGCTGAGATCCCTCGAGGGATCTCAGCTGTATCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-400s21c1
Sequence:CCGGCAAGAGCTGCATCAGTCAAACCTCGAGGTTTGACTGATGCAGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-342s21c1
Sequence:CCGGGACAGAAGAAGATCAGGATACCTCGAGGTATCCTGATCTTCTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-297s21c1
Sequence:CCGGAGAAGAACCAGCAGCTGAAAGCTCGAGCTTTCAGCTGCTGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-193s21c1
Sequence:CCGGCCCTGAGGTCTGGATTCTTTCCTCGAGGAAAGAATCCAGACCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-263s21c1
Sequence:CCGGAGTCCCAGGAGCCCAGTAATGCTCGAGCATTACTGGGCTCCTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-312s21c1
Sequence:CCGGTGAAAGTCGGGATCCTACACCCTCGAGGGTGTAGGATCCCGACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-383s21c1
Sequence:CCGGACATGGAAGGTGATCTGCAAGCTCGAGCTTGCAGATCACCTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-205s21c1
Sequence:CCGGGATTCTTTCTCCGCTACTGAGCTCGAGCTCAGTAGCGGAGAAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001097594
XAGE1B MISSION shRNA shRNA Plasmid DNA
X antigen family, member 1B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-353s21c1
Sequence:CCGGATCAGGATACAGCTGAGATCCCTCGAGGGATCTCAGCTGTATCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-400s21c1
Sequence:CCGGCAAGAGCTGCATCAGTCAAACCTCGAGGTTTGACTGATGCAGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-342s21c1
Sequence:CCGGGACAGAAGAAGATCAGGATACCTCGAGGTATCCTGATCTTCTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-297s21c1
Sequence:CCGGAGAAGAACCAGCAGCTGAAAGCTCGAGCTTTCAGCTGCTGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-193s21c1
Sequence:CCGGCCCTGAGGTCTGGATTCTTTCCTCGAGGAAAGAATCCAGACCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-263s21c1
Sequence:CCGGAGTCCCAGGAGCCCAGTAATGCTCGAGCATTACTGGGCTCCTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-312s21c1
Sequence:CCGGTGAAAGTCGGGATCCTACACCCTCGAGGGTGTAGGATCCCGACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-383s21c1
Sequence:CCGGACATGGAAGGTGATCTGCAAGCTCGAGCTTGCAGATCACCTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-205s21c1
Sequence:CCGGGATTCTTTCTCCGCTACTGAGCTCGAGCTCAGTAGCGGAGAAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001097594
XAGE1B MISSION shRNA Lentiviral Transduction Particles
X antigen family, member 1B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-353s21c1
Sequence:CCGGATCAGGATACAGCTGAGATCCCTCGAGGGATCTCAGCTGTATCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-400s21c1
Sequence:CCGGCAAGAGCTGCATCAGTCAAACCTCGAGGTTTGACTGATGCAGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-342s21c1
Sequence:CCGGGACAGAAGAAGATCAGGATACCTCGAGGTATCCTGATCTTCTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-297s21c1
Sequence:CCGGAGAAGAACCAGCAGCTGAAAGCTCGAGCTTTCAGCTGCTGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-193s21c1
Sequence:CCGGCCCTGAGGTCTGGATTCTTTCCTCGAGGAAAGAATCCAGACCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-263s21c1
Sequence:CCGGAGTCCCAGGAGCCCAGTAATGCTCGAGCATTACTGGGCTCCTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-312s21c1
Sequence:CCGGTGAAAGTCGGGATCCTACACCCTCGAGGGTGTAGGATCCCGACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-383s21c1
Sequence:CCGGACATGGAAGGTGATCTGCAAGCTCGAGCTTGCAGATCACCTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097594.1-205s21c1
Sequence:CCGGGATTCTTTCTCCGCTACTGAGCTCGAGCTCAGTAGCGGAGAAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks