EMAIL THIS PAGE TO A FRIEND

XAGE1C

X antigen family, member 1C

Synonyms: CT12.1 CT12.1C CTP9 GAGED2 XAGE-1
Species: Human XAGE1C(653048)
Gene ID:
Human(653048) Summary: This gene is a member of the XAGE subfamily, which belongs to the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is strongly expressed in Ewing's sarcoma, alveolar rhabdomyosarcoma and normal testis. The protein encoded by this gene contains a nuclear localization signal and shares a sequence similarity with other GAGE/PAGE proteins. Because of the expression pattern and the sequence similarity, this protein also belongs to a family of CT (cancer-testis) antigens. Alternative splicing of this gene, in addition to alternative transcription start sites, results in multiple transcript variants. [provided by RefSeq, Jan 2010]
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001097597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001097597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001097597 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001097597 Rosetta Predictions human pricing
NM_001097598 Rosetta Predictions human pricing
NM_001097602 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318320 predicted 376
2 SASI_Hs02_00318321 predicted 330
3 SASI_Hs02_00318322 predicted 370
4 SASI_Hs02_00318323 predicted 216
5 SASI_Hs02_00318324 predicted 262
6 SASI_Hs02_00318325 predicted 360
7 SASI_Hs02_00318326 predicted 364
8 SASI_Hs02_00318327 predicted 199
9 SASI_Hs02_00318328 predicted 329
10 SASI_Hs02_00318329 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318330 predicted 276
2 SASI_Hs02_00318331 predicted 244
3 SASI_Hs02_00318332 predicted 178
4 SASI_Hs02_00318333 predicted 164
5 SASI_Hs02_00318334 predicted 281
6 SASI_Hs02_00318335 predicted 208
7 SASI_Hs02_00318336 predicted 213
8 SASI_Hs02_00318337 predicted 344
9 SASI_Hs02_00318338 predicted 280
10 SASI_Hs02_00318339 predicted 171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318360 predicted 541
2 SASI_Hs02_00318361 predicted 380
3 SASI_Hs02_00318362 predicted 380
4 SASI_Hs02_00318363 predicted 237
5 SASI_Hs02_00318364 predicted 528
6 SASI_Hs02_00318365 predicted 246
7 SASI_Hs02_00318366 predicted 518
8 SASI_Hs02_00318367 predicted 223
9 SASI_Hs02_00318368 predicted 218
10 SASI_Hs02_00318369 predicted 244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001097597
XAGE1C MISSION shRNA Bacterial Glycerol Stock
X antigen family, member 1C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097597.1-202s21c1
Sequence:CCGGCTGGATTCTTTCTCCGCTACTCTCGAGAGTAGCGGAGAAAGAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097597.1-232s21c1
Sequence:CCGGCGGACACACACAAACACAGAACTCGAGTTCTGTGTTTGTGTGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097597.1-402s21c1
Sequence:CCGGAGAGCTGCATCAGTCAAACACCTCGAGGTGTTTGACTGATGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097597.1-310s21c1
Sequence:CCGGGCTGAAAGTCGGGATCCTACACTCGAGTGTAGGATCCCGACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097597.1-341s21c1
Sequence:CCGGAGACAGAAGAAGATCAGGATACTCGAGTATCCTGATCTTCTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001097597
XAGE1C MISSION shRNA shRNA Plasmid DNA
X antigen family, member 1C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097597.1-202s21c1
Sequence:CCGGCTGGATTCTTTCTCCGCTACTCTCGAGAGTAGCGGAGAAAGAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097597.1-232s21c1
Sequence:CCGGCGGACACACACAAACACAGAACTCGAGTTCTGTGTTTGTGTGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097597.1-402s21c1
Sequence:CCGGAGAGCTGCATCAGTCAAACACCTCGAGGTGTTTGACTGATGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097597.1-310s21c1
Sequence:CCGGGCTGAAAGTCGGGATCCTACACTCGAGTGTAGGATCCCGACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097597.1-341s21c1
Sequence:CCGGAGACAGAAGAAGATCAGGATACTCGAGTATCCTGATCTTCTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001097597
XAGE1C MISSION shRNA Lentiviral Transduction Particles
X antigen family, member 1C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097597.1-202s21c1
Sequence:CCGGCTGGATTCTTTCTCCGCTACTCTCGAGAGTAGCGGAGAAAGAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097597.1-232s21c1
Sequence:CCGGCGGACACACACAAACACAGAACTCGAGTTCTGTGTTTGTGTGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097597.1-402s21c1
Sequence:CCGGAGAGCTGCATCAGTCAAACACCTCGAGGTGTTTGACTGATGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097597.1-310s21c1
Sequence:CCGGGCTGAAAGTCGGGATCCTACACTCGAGTGTAGGATCCCGACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097597.1-341s21c1
Sequence:CCGGAGACAGAAGAAGATCAGGATACTCGAGTATCCTGATCTTCTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks