EMAIL THIS PAGE TO A FRIEND

XAGE1D

X antigen family, member 1D

Synonyms: CT12.1 CT12.1D CTP9
Species: Human XAGE1D(9503)
Gene ID:
Human(9503) Summary: This gene is a member of the XAGE subfamily, which belongs to the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is strongly expressed in Ewing's sarcoma, alveolar rhabdomyosarcoma and normal testis. The protein encoded by this gene contains a nuclear localization signal and shares a sequence similarity with other GAGE/PAGE proteins. Because of the expression pattern and the sequence similarity, this protein also belongs to a family of CT (cancer-testis) antigens. Alternative splicing of this gene, in addition to alternative transcription start sites, results in multiple transcript variants. [provided by RefSeq, Jan 2010]
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133431 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020411 Rosetta Predictions human pricing
NM_133430 Rosetta Predictions human pricing
NM_133431 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157901 predicted 377
2 SASI_Hs02_00353413 predicted 327
3 SASI_Hs01_00157902 predicted 373
4 SASI_Hs01_00157904 predicted 219
5 SASI_Hs01_00157905 predicted 259
6 SASI_Hs01_00157906 predicted 362
7 SASI_Hs01_00157907 predicted 363
8 SASI_Hs01_00157908 predicted 197
9 SASI_Hs02_00353414 predicted 331
10 SASI_Hs01_00157909 predicted 198
11 SASI_Hs01_00157903 predicted 263
12 SASI_Hs01_00157910 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081084 predicted 232
2 SASI_Hs01_00081086 predicted 236
3 SASI_Hs01_00081088 predicted 235
4 SASI_Hs01_00081089 predicted 236
5 SASI_Hs01_00081085 predicted 206
6 SASI_Hs01_00081087 predicted 212
7 SASI_Hs01_00081090 predicted 359
8 SASI_Hs01_00081091 predicted 319
9 SASI_Hs01_00081092 predicted 254
10 SASI_Hs01_00081093 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235867 predicted 544
2 SASI_Hs01_00235868 predicted 387
3 SASI_Hs01_00235869 predicted 384
4 SASI_Hs01_00235870 predicted 237
5 SASI_Hs01_00235871 predicted 524
6 SASI_Hs01_00235873 predicted 245
7 SASI_Hs02_00363100 predicted 516
8 SASI_Hs01_00235874 predicted 223
9 SASI_Hs01_00235875 predicted 215
10 SASI_Hs01_00235876 predicted 237
11 SASI_Hs01_00235872 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133431
XAGE1D MISSION shRNA Bacterial Glycerol Stock
X antigen family, member 1D
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133431.1-612s1c1
Sequence:CCGGCGGCGTCAAGGTGAAGATAATCTCGAGATTATCTTCACCTTGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133431.1-504s1c1
Sequence:CCGGCAGACAGAAGAAGATCAGGATCTCGAGATCCTGATCTTCTTCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133431.1-391s1c1
Sequence:CCGGCATGAGCGACACACACAAACACTCGAGTGTTTGTGTGTGTCGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133431.1-244s1c1
Sequence:CCGGACGGCCATAACTAGGGAGGAACTCGAGTTCCTCCCTAGTTATGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133431.1-546s1c1
Sequence:CCGGGACATGGAAGGTGATCTGCAACTCGAGTTGCAGATCACCTTCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133431
XAGE1D MISSION shRNA shRNA Plasmid DNA
X antigen family, member 1D
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133431.1-612s1c1
Sequence:CCGGCGGCGTCAAGGTGAAGATAATCTCGAGATTATCTTCACCTTGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133431.1-504s1c1
Sequence:CCGGCAGACAGAAGAAGATCAGGATCTCGAGATCCTGATCTTCTTCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133431.1-391s1c1
Sequence:CCGGCATGAGCGACACACACAAACACTCGAGTGTTTGTGTGTGTCGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133431.1-244s1c1
Sequence:CCGGACGGCCATAACTAGGGAGGAACTCGAGTTCCTCCCTAGTTATGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133431.1-546s1c1
Sequence:CCGGGACATGGAAGGTGATCTGCAACTCGAGTTGCAGATCACCTTCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133431
XAGE1D MISSION shRNA Lentiviral Transduction Particles
X antigen family, member 1D
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133431.1-612s1c1
Sequence:CCGGCGGCGTCAAGGTGAAGATAATCTCGAGATTATCTTCACCTTGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133431.1-504s1c1
Sequence:CCGGCAGACAGAAGAAGATCAGGATCTCGAGATCCTGATCTTCTTCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133431.1-391s1c1
Sequence:CCGGCATGAGCGACACACACAAACACTCGAGTGTTTGTGTGTGTCGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133431.1-244s1c1
Sequence:CCGGACGGCCATAACTAGGGAGGAACTCGAGTTCCTCCCTAGTTATGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133431.1-546s1c1
Sequence:CCGGGACATGGAAGGTGATCTGCAACTCGAGTTGCAGATCACCTTCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks