EMAIL THIS PAGE TO A FRIEND

XAGE1E

X antigen family, member 1E

Synonyms: CT12.1 CT12.1E CTP9 GAGED2 XAGE-1
Species: Human XAGE1E(653067)
Gene ID:
Human(653067) Summary: This gene is a member of the XAGE subfamily, which belongs to the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is strongly expressed in Ewing's sarcoma, alveolar rhabdomyosarcoma and normal testis. The protein encoded by this gene contains a nuclear localization signal and shares a sequence similarity with other GAGE/PAGE proteins. Because of the expression pattern and the sequence similarity, this protein also belongs to a family of CT (cancer-testis) antigens. Alternative splicing of this gene, in addition to alternative transcription start sites, results in multiple transcript variants. [provided by RefSeq, Jan 2010]
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001097603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001097603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001097603 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001097603 Rosetta Predictions human pricing
NM_001097604 Rosetta Predictions human pricing
NM_001097605 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318370 predicted 546
2 SASI_Hs02_00318371 predicted 385
3 SASI_Hs02_00318372 predicted 382
4 SASI_Hs02_00318373 predicted 229
5 SASI_Hs02_00318374 predicted 523
6 SASI_Hs02_00318375 predicted 244
7 SASI_Hs02_00318376 predicted 516
8 SASI_Hs02_00318377 predicted 219
9 SASI_Hs02_00318378 predicted 212
10 SASI_Hs02_00318379 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318380 predicted 377
2 SASI_Hs02_00318381 predicted 326
3 SASI_Hs02_00318382 predicted 376
4 SASI_Hs02_00318383 predicted 220
5 SASI_Hs02_00318384 predicted 259
6 SASI_Hs02_00318385 predicted 355
7 SASI_Hs02_00318386 predicted 362
8 SASI_Hs02_00318387 predicted 197
9 SASI_Hs02_00318388 predicted 329
10 SASI_Hs02_00318389 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318390 predicted 279
2 SASI_Hs02_00318391 predicted 242
3 SASI_Hs02_00318392 predicted 175
4 SASI_Hs02_00318393 predicted 163
5 SASI_Hs02_00318394 predicted 279
6 SASI_Hs02_00318395 predicted 211
7 SASI_Hs02_00318396 predicted 212
8 SASI_Hs02_00318397 predicted 344
9 SASI_Hs02_00318398 predicted 282
10 SASI_Hs02_00318399 predicted 172
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001097603
XAGE1E MISSION shRNA Bacterial Glycerol Stock
X antigen family, member 1E
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097603.1-475s21c1
Sequence:CCGGCTGAAAGTCGGGATCCTACACCTCGAGGTGTAGGATCCCGACTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097603.1-392s21c1
Sequence:CCGGATGAGCGACACACACAAACACCTCGAGGTGTTTGTGTGTGTCGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097603.1-234s21c1
Sequence:CCGGTTGTCTCGTCACGGCCATAACCTCGAGGTTATGGCCGTGACGAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097603.1-557s21c1
Sequence:CCGGTGATCTGCAAGAGCTGCATCACTCGAGTGATGCAGCTCTTGCAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097603.1-426s21c1
Sequence:CCGGCAGTCCCAGGAGCCCAGTAATCTCGAGATTACTGGGCTCCTGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001097603
XAGE1E MISSION shRNA shRNA Plasmid DNA
X antigen family, member 1E
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097603.1-475s21c1
Sequence:CCGGCTGAAAGTCGGGATCCTACACCTCGAGGTGTAGGATCCCGACTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097603.1-392s21c1
Sequence:CCGGATGAGCGACACACACAAACACCTCGAGGTGTTTGTGTGTGTCGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097603.1-234s21c1
Sequence:CCGGTTGTCTCGTCACGGCCATAACCTCGAGGTTATGGCCGTGACGAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097603.1-557s21c1
Sequence:CCGGTGATCTGCAAGAGCTGCATCACTCGAGTGATGCAGCTCTTGCAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097603.1-426s21c1
Sequence:CCGGCAGTCCCAGGAGCCCAGTAATCTCGAGATTACTGGGCTCCTGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001097603
XAGE1E MISSION shRNA Lentiviral Transduction Particles
X antigen family, member 1E
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097603.1-475s21c1
Sequence:CCGGCTGAAAGTCGGGATCCTACACCTCGAGGTGTAGGATCCCGACTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097603.1-392s21c1
Sequence:CCGGATGAGCGACACACACAAACACCTCGAGGTGTTTGTGTGTGTCGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097603.1-234s21c1
Sequence:CCGGTTGTCTCGTCACGGCCATAACCTCGAGGTTATGGCCGTGACGAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097603.1-557s21c1
Sequence:CCGGTGATCTGCAAGAGCTGCATCACTCGAGTGATGCAGCTCTTGCAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097603.1-426s21c1
Sequence:CCGGCAGTCCCAGGAGCCCAGTAATCTCGAGATTACTGGGCTCCTGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks