EMAIL THIS PAGE TO A FRIEND

XAGE2

X antigen family, member 2

Synonyms: CT12.2 GAGED3 XAGE-2
Species: Human XAGE2(9502)
UniProtKB ID: Q96GT9, Q5HYR4
Gene ID:
Human(9502) Summary: This gene is a member of the XAGE subfamily, which belongs to the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is strongly expressed in normal testis, and in Ewing's sarcoma, rhabdomyosarcoma, a breast cancer and a germ cell tumor. The protein encoded by this gene shares a sequence similarity with other GAGE/PAGE proteins. Because of the expression pattern and the sequence similarity, this protein also belongs to a family of CT (cancer-testis) antigens. [provided by RefSeq, Jul 2008]
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130777 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130777 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130777 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130777 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131051 predicted 316
2 SASI_Hs01_00131052 predicted 365
3 SASI_Hs01_00131053 predicted 373
4 SASI_Hs01_00131054 predicted 362
5 SASI_Hs01_00131055 predicted 372
6 SASI_Hs01_00131056 predicted 312
7 SASI_Hs01_00131057 predicted 387
8 SASI_Hs01_00131058 predicted 417
9 SASI_Hs01_00131059 predicted 483
10 SASI_Hs01_00131060 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130777
XAGE2 MISSION shRNA Bacterial Glycerol Stock
X antigen family, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130777.1-456s21c1
Sequence:CCGGGGGTGCAGCTGAGATTCAAGTCTCGAGACTTGAATCTCAGCTGCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130777.1-437s21c1
Sequence:CCGGAGAAGAGAGAAGATGATCAGGCTCGAGCCTGATCATCTTCTCTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130777.1-531s21c1
Sequence:CCGGATGTGAAGGTGGTACTGATGTCTCGAGACATCAGTACCACCTTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130777.1-604s21c1
Sequence:CCGCGAAGGGAAATCACAGGTTTAACTCGAGTTAAACCTGTGATTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130777.1-373s1c1
Sequence:CCGGCCCACTGATGAAGAGCCTAAACTCGAGTTTAGGCTCTTCATCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130777.1-318s1c1
Sequence:CCGGGCCTAGGCCAAGAAGAAGTTTCTCGAGAAACTTCTTCTTGGCCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130777.1-497s1c1
Sequence:CCGGTCCAGGAGCTATGTCAGACAACTCGAGTTGTCTGACATAGCTCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130777.1-394s1c1
Sequence:CCGGGAAGAGAAACCACCCACTAAACTCGAGTTTAGTGGGTGGTTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130777.1-361s1c1
Sequence:CCGGGCTATGCTTGAACCCACTGATCTCGAGATCAGTGGGTTCAAGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130777
XAGE2 MISSION shRNA shRNA Plasmid DNA
X antigen family, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130777.1-456s21c1
Sequence:CCGGGGGTGCAGCTGAGATTCAAGTCTCGAGACTTGAATCTCAGCTGCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130777.1-437s21c1
Sequence:CCGGAGAAGAGAGAAGATGATCAGGCTCGAGCCTGATCATCTTCTCTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130777.1-531s21c1
Sequence:CCGGATGTGAAGGTGGTACTGATGTCTCGAGACATCAGTACCACCTTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130777.1-604s21c1
Sequence:CCGCGAAGGGAAATCACAGGTTTAACTCGAGTTAAACCTGTGATTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130777.1-373s1c1
Sequence:CCGGCCCACTGATGAAGAGCCTAAACTCGAGTTTAGGCTCTTCATCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130777.1-318s1c1
Sequence:CCGGGCCTAGGCCAAGAAGAAGTTTCTCGAGAAACTTCTTCTTGGCCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130777.1-497s1c1
Sequence:CCGGTCCAGGAGCTATGTCAGACAACTCGAGTTGTCTGACATAGCTCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130777.1-394s1c1
Sequence:CCGGGAAGAGAAACCACCCACTAAACTCGAGTTTAGTGGGTGGTTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130777.1-361s1c1
Sequence:CCGGGCTATGCTTGAACCCACTGATCTCGAGATCAGTGGGTTCAAGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130777
XAGE2 MISSION shRNA Lentiviral Transduction Particles
X antigen family, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130777.1-456s21c1
Sequence:CCGGGGGTGCAGCTGAGATTCAAGTCTCGAGACTTGAATCTCAGCTGCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130777.1-437s21c1
Sequence:CCGGAGAAGAGAGAAGATGATCAGGCTCGAGCCTGATCATCTTCTCTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130777.1-531s21c1
Sequence:CCGGATGTGAAGGTGGTACTGATGTCTCGAGACATCAGTACCACCTTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130777.1-604s21c1
Sequence:CCGCGAAGGGAAATCACAGGTTTAACTCGAGTTAAACCTGTGATTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130777.1-373s1c1
Sequence:CCGGCCCACTGATGAAGAGCCTAAACTCGAGTTTAGGCTCTTCATCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130777.1-318s1c1
Sequence:CCGGGCCTAGGCCAAGAAGAAGTTTCTCGAGAAACTTCTTCTTGGCCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130777.1-497s1c1
Sequence:CCGGTCCAGGAGCTATGTCAGACAACTCGAGTTGTCTGACATAGCTCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130777.1-394s1c1
Sequence:CCGGGAAGAGAAACCACCCACTAAACTCGAGTTTAGTGGGTGGTTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130777.1-361s1c1
Sequence:CCGGGCTATGCTTGAACCCACTGATCTCGAGATCAGTGGGTTCAAGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks