EMAIL THIS PAGE TO A FRIEND

XAGE2B

X antigen family, member 2B

Synonyms: XAGE-2
Species: Human XAGE2B(728242)
Gene ID:
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001079538 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001079538 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001079538 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079538 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313580 predicted 209
2 SASI_Hs02_00313581 predicted 82
3 SASI_Hs02_00313582 predicted 87
4 SASI_Hs02_00313583 predicted 77
5 SASI_Hs02_00313584 predicted 209
6 SASI_Hs02_00313585 predicted 102
7 SASI_Hs02_00313586 predicted 130
8 SASI_Hs02_00313587 predicted 195
9 SASI_Hs02_00313588 predicted 88
10 SASI_Hs02_00313589 predicted 85
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001079538
XAGE2B MISSION shRNA Bacterial Glycerol Stock
X antigen family, member 2B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079538.1-164s21c1
Sequence:CCGGATCAGGGTGCAGCTGAGATTCCTCGAGGAATCTCAGCTGCACCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079538.1-32s21c1
Sequence:CCGGCTAGGCCAAGAAGAAGTTTACCTCGAGGTAAACTTCTTCTTGGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079538.1-132s21c1
Sequence:CCGGGAATCCTACACCTGATCAGAACTCGAGTTCTGATCAGGTGTAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079538.1-75s21c1
Sequence:CCGGTATGCTTGAACCCACTGATGACTCGAGTCATCAGTGGGTTCAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079538.1-86s21c1
Sequence:CCGGCCACTGATGAAGAGCCTAAAGCTCGAGCTTTAGGCTCTTCATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001079538
XAGE2B MISSION shRNA shRNA Plasmid DNA
X antigen family, member 2B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079538.1-164s21c1
Sequence:CCGGATCAGGGTGCAGCTGAGATTCCTCGAGGAATCTCAGCTGCACCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079538.1-32s21c1
Sequence:CCGGCTAGGCCAAGAAGAAGTTTACCTCGAGGTAAACTTCTTCTTGGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079538.1-132s21c1
Sequence:CCGGGAATCCTACACCTGATCAGAACTCGAGTTCTGATCAGGTGTAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079538.1-75s21c1
Sequence:CCGGTATGCTTGAACCCACTGATGACTCGAGTCATCAGTGGGTTCAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079538.1-86s21c1
Sequence:CCGGCCACTGATGAAGAGCCTAAAGCTCGAGCTTTAGGCTCTTCATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001079538
XAGE2B MISSION shRNA Lentiviral Transduction Particles
X antigen family, member 2B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079538.1-164s21c1
Sequence:CCGGATCAGGGTGCAGCTGAGATTCCTCGAGGAATCTCAGCTGCACCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079538.1-32s21c1
Sequence:CCGGCTAGGCCAAGAAGAAGTTTACCTCGAGGTAAACTTCTTCTTGGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079538.1-132s21c1
Sequence:CCGGGAATCCTACACCTGATCAGAACTCGAGTTCTGATCAGGTGTAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079538.1-75s21c1
Sequence:CCGGTATGCTTGAACCCACTGATGACTCGAGTCATCAGTGGGTTCAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079538.1-86s21c1
Sequence:CCGGCCACTGATGAAGAGCCTAAAGCTCGAGCTTTAGGCTCTTCATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks