EMAIL THIS PAGE TO A FRIEND

XAGE5

X antigen family, member 5

Synonyms: CT12.5 GAGED5 XAGE-5
Species: Human XAGE5(170627)
UniProtKB ID: Q8WWM1, Q5JS81
Gene ID:
Human(170627) Summary: This gene is a member of the XAGE subfamily, which belongs to the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. The protein encoded by this gene shares a sequence similarity with other GAGE/PAGE proteins. Because of the expression pattern and the sequence similarity, this protein also belongs to a family of CT (cancer-testis) antigens. [provided by RefSeq, Jul 2008]
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130775 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130775 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028971 predicted 411
2 SASI_Hs01_00028972 predicted 414
3 SASI_Hs01_00028973 predicted 81
4 SASI_Hs01_00028974 predicted 112
5 SASI_Hs02_00362807 predicted 187
6 SASI_Hs01_00028976 predicted 375
7 SASI_Hs01_00028977 predicted 92
8 SASI_Hs01_00028975 predicted 119
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130775
XAGE5 MISSION shRNA Bacterial Glycerol Stock
X antigen family, member 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130775.1-129s1c1
Sequence:CCGGGCCTATGCTTGAGCCCAGTGTCTCGAGACACTGGGCTCAAGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130775.1-199s1c1
Sequence:CCGGCCTGGTCAGAAGAGAGAAGATCTCGAGATCTTCTCTCTTCTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130775.1-172s1c1
Sequence:CCGGCCACCAACTGAAAGTCAGGATCTCGAGATCCTGACTTTCAGTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130775.1-151s1c1
Sequence:CCGGCCAGAGCCTCAACAAGAAGAACTCGAGTTCTTCTTGTTGAGGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130775.1-94s1c1
Sequence:CCGGCCAAGACGATGTTTACGACTTCTCGAGAAGTCGTAAACATCGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130775.2-218s21c1
Sequence:CCGGTGATCAGGGTGCAGCTGAGATCTCGAGATCTCAGCTGCACCCTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130775.2-231s21c1
Sequence:CCGGGCTGAGATTCAAGTGCCTAACCTCGAGGTTAGGCACTTGAATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130775.2-371s21c1
Sequence:CCGGGGAAGGGAAACCACAGCTTTACTCGAGTAAAGCTGTGGTTTCCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130775.2-246s21c1
Sequence:CCGGCCTAACCTGGAAGCTGATCTCCTCGAGGAGATCAGCTTCCAGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130775
XAGE5 MISSION shRNA shRNA Plasmid DNA
X antigen family, member 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130775.1-129s1c1
Sequence:CCGGGCCTATGCTTGAGCCCAGTGTCTCGAGACACTGGGCTCAAGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130775.1-199s1c1
Sequence:CCGGCCTGGTCAGAAGAGAGAAGATCTCGAGATCTTCTCTCTTCTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130775.1-172s1c1
Sequence:CCGGCCACCAACTGAAAGTCAGGATCTCGAGATCCTGACTTTCAGTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130775.1-151s1c1
Sequence:CCGGCCAGAGCCTCAACAAGAAGAACTCGAGTTCTTCTTGTTGAGGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130775.1-94s1c1
Sequence:CCGGCCAAGACGATGTTTACGACTTCTCGAGAAGTCGTAAACATCGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130775.2-218s21c1
Sequence:CCGGTGATCAGGGTGCAGCTGAGATCTCGAGATCTCAGCTGCACCCTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130775.2-231s21c1
Sequence:CCGGGCTGAGATTCAAGTGCCTAACCTCGAGGTTAGGCACTTGAATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130775.2-371s21c1
Sequence:CCGGGGAAGGGAAACCACAGCTTTACTCGAGTAAAGCTGTGGTTTCCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130775.2-246s21c1
Sequence:CCGGCCTAACCTGGAAGCTGATCTCCTCGAGGAGATCAGCTTCCAGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130775
XAGE5 MISSION shRNA Lentiviral Transduction Particles
X antigen family, member 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130775.1-129s1c1
Sequence:CCGGGCCTATGCTTGAGCCCAGTGTCTCGAGACACTGGGCTCAAGCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130775.1-199s1c1
Sequence:CCGGCCTGGTCAGAAGAGAGAAGATCTCGAGATCTTCTCTCTTCTGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130775.1-172s1c1
Sequence:CCGGCCACCAACTGAAAGTCAGGATCTCGAGATCCTGACTTTCAGTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130775.1-151s1c1
Sequence:CCGGCCAGAGCCTCAACAAGAAGAACTCGAGTTCTTCTTGTTGAGGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130775.1-94s1c1
Sequence:CCGGCCAAGACGATGTTTACGACTTCTCGAGAAGTCGTAAACATCGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130775.2-218s21c1
Sequence:CCGGTGATCAGGGTGCAGCTGAGATCTCGAGATCTCAGCTGCACCCTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130775.2-231s21c1
Sequence:CCGGGCTGAGATTCAAGTGCCTAACCTCGAGGTTAGGCACTTGAATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130775.2-371s21c1
Sequence:CCGGGGAAGGGAAACCACAGCTTTACTCGAGTAAAGCTGTGGTTTCCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130775.2-246s21c1
Sequence:CCGGCCTAACCTGGAAGCTGATCTCCTCGAGGAGATCAGCTTCCAGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks