EMAIL THIS PAGE TO A FRIEND

XBP1

X-box binding protein 1

Synonyms: TREB5 XBP-1 XBP2
UniProtKB ID: P17861, Q8WYK6, Q969P1, Q96BD7
Gene ID:
Human(7494) Summary: This gene encodes a transcription factor that regulates MHC class II genes by binding to a promoter element referred to as an X box. This gene product is a bZIP protein, which was also identified as a cellular transcription factor that binds to an enhancer in the promoter of the T cell leukemia virus type 1 promoter. It may increase expression of viral proteins by acting as the DNA binding partner of a viral transactivator. It has been found that upon accumulation of unfolded proteins in the endoplasmic reticulum (ER), the mRNA of this gene is processed to an active form by an unconventional splicing mechanism that is mediated by the endonuclease inositol-requiring enzyme 1 (IRE1). The resulting loss of 26 nt from the spliced mRNA causes a frame-shift and an isoform XBP1(S), which is the functionally active transcription factor. The isoform encoded by the unspliced mRNA, XBP1(U), is constitutively expressed, and thought to function as a negative feedback regulator of XBP1(S), which shuts off transcription of target genes during the recovery phase of ER stress. A pseudogene of XBP1 has been identified and localized to chromosome 5. [provided by RefSeq, Jul 2008]
Mouse(22433) X-box binding protein 1
Rat(289754) X-box binding protein 1
fruit fly(44226) X box binding protein-1
Zebrafish(140614) X-box binding protein 1
dog(477532) X-box binding protein 1
chicken(416918) X-box binding protein 1
cow(541236) X-box binding protein 1
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500381 Anti-XBP-1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunocytochemistry, western blot pricing
SAB2108518 Anti-XBP1 affinity isolated antibody human, canine, rabbit, rat, pig, horse, bovine
western blot pricing
GW21291 Anti-XBP1 (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
AV38553 Anti-XBP1 (AB1) antibody produced in rabbit affinity isolated antibody human, mouse, horse, pig, rabbit, rat, bovine
western blot pricing
GW22509 Anti-XBP1 (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
AV38552 Anti-XBP1 (AB2) antibody produced in rabbit affinity isolated antibody horse, human, pig, bovine, rabbit
western blot pricing
SAB1406598 Anti-XBP1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2102720 Anti-XBP1 antibody produced in rabbit affinity isolated antibody zebrafish, human, mouse, pig, bovine, rabbit, rat, horse
western blot pricing
HPA044305 Anti-XBP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2501118 Anti-XBP1/TREB5 affinity isolated antibody, buffered aqueous solution mouse, human, canine
ELISA, western blot pricing
SAB3500473 Monoclonal Anti-XBP-1 antibody produced in mouse clone 3H1G4, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunocytochemistry, western blot pricing
SAB3500474 Monoclonal Anti-XBP-1 antibody produced in mouse clone 9B7E5, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, immunocytochemistry, western blot pricing
WH0007494M1 Monoclonal Anti-XBP1 antibody produced in mouse clone 3F5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404531 Monoclonal Anti-XBP1 antibody produced in mouse clone 2D9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005080 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013842 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013842 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013842 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079539 Rosetta Predictions human pricing
NM_005080 Rosetta Predictions human pricing
NM_001004210 Rosetta Predictions rat pricing
NM_013842 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313590 predicted 1294
2 SASI_Hs02_00313591 predicted 1155
3 SASI_Hs02_00313592 predicted 908
4 SASI_Hs02_00313593 predicted 1268
5 SASI_Hs02_00313594 predicted 862
6 SASI_Hs02_00313595 predicted 1284
7 SASI_Hs02_00313596 predicted 1025
8 SASI_Hs02_00313597 predicted 1369
9 SASI_Hs02_00313598 predicted 1164
10 SASI_Hs02_00313599 predicted 1461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051619 predicted 1189
2 SASI_Hs02_00338921 predicted 1256
3 SASI_Hs01_00051621 predicted 938
4 SASI_Hs02_00338922 predicted 1294
5 SASI_Hs01_00051623 predicted 889
6 SASI_Hs02_00338923 predicted 1062
7 SASI_Hs02_00338924 predicted 1318
8 SASI_Hs01_00051624 predicted 1196
9 SASI_Hs02_00338925 predicted 883
10 SASI_Hs02_00338926 predicted 1125
11 SASI_Hs01_00051618 predicted 1311
12 SASI_Hs01_00051620 predicted 1307
13 SASI_Hs01_00051622 predicted 652
14 SASI_Hs01_00051625 predicted 1074
15 SASI_Hs01_00051626 predicted 1211
16 SASI_Hs01_00051627 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198190 predicted 539
2 SASI_Rn01_00075685 predicted 1170
3 SASI_Rn01_00075686 predicted 1228
4 SASI_Rn01_00075687 predicted 835
5 SASI_Rn02_00198191 predicted 963
6 SASI_Rn01_00075688 predicted 1232
7 SASI_Rn02_00198192 predicted 1244
8 SASI_Rn01_00075690 predicted 356
9 SASI_Rn01_00075692 predicted 1057
10 SASI_Rn01_00075694 predicted 534
11 SASI_Rn01_00075689 predicted 1246
12 SASI_Rn01_00075691 predicted 925
13 SASI_Rn01_00075693 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013842 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048946 predicted 924
2 SASI_Mm01_00048947 predicted 848
3 SASI_Mm01_00048948 predicted 985
4 SASI_Mm01_00048949 predicted 560
5 SASI_Mm01_00048950 predicted 1274
6 SASI_Mm01_00048951 predicted 1316
7 SASI_Mm01_00048952 predicted 853
8 SASI_Mm02_00322842 predicted 940
9 SASI_Mm02_00322843 predicted 858
10 SASI_Mm02_00322844 predicted 329
11 SASI_Mm01_00048953 predicted 1290
12 SASI_Mm01_00048954 predicted 400
13 SASI_Mm01_00048955 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005080
VALIDATED
XBP1 MISSION shRNA Bacterial Glycerol Stock
X-box binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005080.3-681s21c1
Sequence:CCGGGACCCAGTCATGTTCTTCAAACTCGAGTTTGAAGAACATGACTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005080.3-312s21c1
Sequence:CCGGAGATCGAAAGAAGGCTCGAATCTCGAGATTCGAGCCTTCTTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005080.3-343s21c1
Sequence:CCGGGAACAGCAAGTGGTAGATTTACTCGAGTAAATCTACCACTTGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005080.3-622s21c1
Sequence:CCGGGCGGTATTGACTCTTCAGATTCTCGAGAATCTGAAGAGTCAATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005080.3-1269s21c1
Sequence:CCGGGCCTGTCTGTACTTCATTCAACTCGAGTTGAATGAAGTACAGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005080.2-1269s1c1
Sequence:CCGGGCCTGTCTGTACTTCATTCAACTCGAGTTGAATGAAGTACAGACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005080.2-622s1c1
Sequence:CCGGGCGGTATTGACTCTTCAGATTCTCGAGAATCTGAAGAGTCAATACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005080.2-343s1c1
Sequence:CCGGGAACAGCAAGTGGTAGATTTACTCGAGTAAATCTACCACTTGCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005080.2-312s1c1
Sequence:CCGGAGATCGAAAGAAGGCTCGAATCTCGAGATTCGAGCCTTCTTTCGATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005080.2-681s1c1
Sequence:CCGGGACCCAGTCATGTTCTTCAAACTCGAGTTTGAAGAACATGACTGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005080
VALIDATED
XBP1 MISSION shRNA shRNA Plasmid DNA
X-box binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005080.3-681s21c1
Sequence:CCGGGACCCAGTCATGTTCTTCAAACTCGAGTTTGAAGAACATGACTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005080.3-312s21c1
Sequence:CCGGAGATCGAAAGAAGGCTCGAATCTCGAGATTCGAGCCTTCTTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005080.3-343s21c1
Sequence:CCGGGAACAGCAAGTGGTAGATTTACTCGAGTAAATCTACCACTTGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005080.3-622s21c1
Sequence:CCGGGCGGTATTGACTCTTCAGATTCTCGAGAATCTGAAGAGTCAATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005080.3-1269s21c1
Sequence:CCGGGCCTGTCTGTACTTCATTCAACTCGAGTTGAATGAAGTACAGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005080.2-1269s1c1
Sequence:CCGGGCCTGTCTGTACTTCATTCAACTCGAGTTGAATGAAGTACAGACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005080.2-622s1c1
Sequence:CCGGGCGGTATTGACTCTTCAGATTCTCGAGAATCTGAAGAGTCAATACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005080.2-343s1c1
Sequence:CCGGGAACAGCAAGTGGTAGATTTACTCGAGTAAATCTACCACTTGCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005080.2-312s1c1
Sequence:CCGGAGATCGAAAGAAGGCTCGAATCTCGAGATTCGAGCCTTCTTTCGATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005080.2-681s1c1
Sequence:CCGGGACCCAGTCATGTTCTTCAAACTCGAGTTTGAAGAACATGACTGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005080
VALIDATED
XBP1 MISSION shRNA Lentiviral Transduction Particles
X-box binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005080.3-681s21c1
Sequence:CCGGGACCCAGTCATGTTCTTCAAACTCGAGTTTGAAGAACATGACTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005080.3-312s21c1
Sequence:CCGGAGATCGAAAGAAGGCTCGAATCTCGAGATTCGAGCCTTCTTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005080.3-343s21c1
Sequence:CCGGGAACAGCAAGTGGTAGATTTACTCGAGTAAATCTACCACTTGCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005080.3-622s21c1
Sequence:CCGGGCGGTATTGACTCTTCAGATTCTCGAGAATCTGAAGAGTCAATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005080.3-1269s21c1
Sequence:CCGGGCCTGTCTGTACTTCATTCAACTCGAGTTGAATGAAGTACAGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005080.2-1269s1c1
Sequence:CCGGGCCTGTCTGTACTTCATTCAACTCGAGTTGAATGAAGTACAGACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005080.2-622s1c1
Sequence:CCGGGCGGTATTGACTCTTCAGATTCTCGAGAATCTGAAGAGTCAATACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005080.2-343s1c1
Sequence:CCGGGAACAGCAAGTGGTAGATTTACTCGAGTAAATCTACCACTTGCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005080.2-312s1c1
Sequence:CCGGAGATCGAAAGAAGGCTCGAATCTCGAGATTCGAGCCTTCTTTCGATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005080.2-681s1c1
Sequence:CCGGGACCCAGTCATGTTCTTCAAACTCGAGTTTGAAGAACATGACTGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013842
VALIDATED
XBP1 MISSION shRNA Bacterial Glycerol Stock
X-box binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013842.2-321s21c1
Sequence:CCGGTGGAAGAAGAGAACCACAAACCTCGAGGTTTGTGGTTCTCTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013842.2-503s21c1
Sequence:CCGGTCCGCAGCACTCAGACTATGTCTCGAGACATAGTCTGAGTGCTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013842.2-1229s21c1
Sequence:CCGGAGGCCTGTCTCTTTCGTTAAACTCGAGTTTAACGAAAGAGACAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013842.2-710s21c1
Sequence:CCGGTCTACCCAGAAGGACCTAGTTCTCGAGAACTAGGTCCTTCTGGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013842.2-388s21c1
Sequence:CCGGGGTTGAGAACCAGGAGTTAAGCTCGAGCTTAACTCCTGGTTCTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013842.2-397s1c1
Sequence:CCGGCCAGGAGTTAAGAACACGCTTCTCGAGAAGCGTGTTCTTAACTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013842.2-785s1c1
Sequence:CCGGCCATTAATGAACTCATTCGTTCTCGAGAACGAATGAGTTCATTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013842.2-271s1c1
Sequence:CCGGAGATAGAAAGAAAGCCCGGATCTCGAGATCCGGGCTTTCTTTCTATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013842.2-1151s1c1
Sequence:CCGGCCCAGCTGATTAGTGTCTAAACTCGAGTTTAGACACTAATCAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013842.2-710s1c1
Sequence:CCGGTCTACCCAGAAGGACCTAGTTCTCGAGAACTAGGTCCTTCTGGGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013842
VALIDATED
XBP1 MISSION shRNA shRNA Plasmid DNA
X-box binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013842.2-321s21c1
Sequence:CCGGTGGAAGAAGAGAACCACAAACCTCGAGGTTTGTGGTTCTCTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013842.2-503s21c1
Sequence:CCGGTCCGCAGCACTCAGACTATGTCTCGAGACATAGTCTGAGTGCTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013842.2-1229s21c1
Sequence:CCGGAGGCCTGTCTCTTTCGTTAAACTCGAGTTTAACGAAAGAGACAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013842.2-710s21c1
Sequence:CCGGTCTACCCAGAAGGACCTAGTTCTCGAGAACTAGGTCCTTCTGGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013842.2-388s21c1
Sequence:CCGGGGTTGAGAACCAGGAGTTAAGCTCGAGCTTAACTCCTGGTTCTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013842.2-397s1c1
Sequence:CCGGCCAGGAGTTAAGAACACGCTTCTCGAGAAGCGTGTTCTTAACTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013842.2-785s1c1
Sequence:CCGGCCATTAATGAACTCATTCGTTCTCGAGAACGAATGAGTTCATTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013842.2-271s1c1
Sequence:CCGGAGATAGAAAGAAAGCCCGGATCTCGAGATCCGGGCTTTCTTTCTATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013842.2-1151s1c1
Sequence:CCGGCCCAGCTGATTAGTGTCTAAACTCGAGTTTAGACACTAATCAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013842.2-710s1c1
Sequence:CCGGTCTACCCAGAAGGACCTAGTTCTCGAGAACTAGGTCCTTCTGGGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013842
VALIDATED
XBP1 MISSION shRNA Lentiviral Transduction Particles
X-box binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013842.2-321s21c1
Sequence:CCGGTGGAAGAAGAGAACCACAAACCTCGAGGTTTGTGGTTCTCTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013842.2-503s21c1
Sequence:CCGGTCCGCAGCACTCAGACTATGTCTCGAGACATAGTCTGAGTGCTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013842.2-1229s21c1
Sequence:CCGGAGGCCTGTCTCTTTCGTTAAACTCGAGTTTAACGAAAGAGACAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013842.2-710s21c1
Sequence:CCGGTCTACCCAGAAGGACCTAGTTCTCGAGAACTAGGTCCTTCTGGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013842.2-388s21c1
Sequence:CCGGGGTTGAGAACCAGGAGTTAAGCTCGAGCTTAACTCCTGGTTCTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013842.2-397s1c1
Sequence:CCGGCCAGGAGTTAAGAACACGCTTCTCGAGAAGCGTGTTCTTAACTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013842.2-785s1c1
Sequence:CCGGCCATTAATGAACTCATTCGTTCTCGAGAACGAATGAGTTCATTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013842.2-271s1c1
Sequence:CCGGAGATAGAAAGAAAGCCCGGATCTCGAGATCCGGGCTTTCTTTCTATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013842.2-1151s1c1
Sequence:CCGGCCCAGCTGATTAGTGTCTAAACTCGAGTTTAGACACTAATCAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013842.2-710s1c1
Sequence:CCGGTCTACCCAGAAGGACCTAGTTCTCGAGAACTAGGTCCTTCTGGGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks