EMAIL THIS PAGE TO A FRIEND

XCL1

chemokine (C motif) ligand 1

Synonyms: ATAC LPTN LTN SCM-1 SCM-1a SCM1 SCM1A SCYC1
UniProtKB ID: P47992, Q52MA8
Gene ID:
Human(6375) Summary: This gene encodes a member of the chemokine superfamily. Chemokines function in inflammatory and immunological responses, inducing leukocyte migration and activation. The encoded protein is a member of the C-chemokine subfamily, retaining only two of four cysteines conserved in other chemokines, and is thought to be specifically chemotactic for T cells. This gene and a closely related family member are located on the long arm of chromosome 1. [provided by RefSeq, Nov 2010]
Mouse(16963) chemokine (C motif) ligand 1
Rat(171371) chemokine (C motif) ligand 1
dog(490356) chemokine (C motif) ligand 1
domestic guinea pig(100714756) chemokine (C motif) ligand 1
cow(319096) chemokine (C motif) ligand 1
sheep(443448) chemokine (C motif) ligand 1
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002995 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002995 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002995 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109771 MISSION® esiRNA esiRNA human XCL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002995 Rosetta Predictions human pricing
NM_134361 Rosetta Predictions rat pricing
NM_008510 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237479 predicted 799
2 SASI_Hs01_00237486 predicted 756
3 SASI_Hs01_00237480 predicted 266
4 SASI_Hs01_00237482 predicted 749
5 SASI_Hs01_00237483 predicted 297
6 SASI_Hs01_00237484 predicted 778
7 SASI_Hs01_00237485 predicted 843
8 SASI_Hs02_00334871 predicted 289
9 SASI_Hs01_00237481 predicted 272
10 SASI_Hs01_00237487 predicted 643
11 SASI_Hs01_00237488 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061653 predicted 194
2 SASI_Rn01_00061654 predicted 272
3 SASI_Rn01_00061655 predicted 80
4 SASI_Rn01_00061656 predicted 158
5 SASI_Rn01_00061657 predicted 150
6 SASI_Rn01_00061658 predicted 182
7 SASI_Rn01_00061659 predicted 86
8 SASI_Rn01_00061660 predicted 33
9 SASI_Rn01_00061661 predicted 192
10 SASI_Rn01_00061662 predicted 83
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096020 predicted 272
2 SASI_Mm01_00096021 predicted 245
3 SASI_Mm01_00096022 predicted 192
4 SASI_Mm01_00096023 predicted 274
5 SASI_Mm01_00096024 predicted 224
6 SASI_Mm01_00096025 predicted 272
7 SASI_Mm01_00096026 predicted 246
8 SASI_Mm01_00096027 predicted 273
9 SASI_Mm01_00096028 predicted 267
10 SASI_Mm01_00096029 predicted 238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002995
XCL1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C motif) ligand 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002995.1-278s1c1
Sequence:CCGGGAAATCCAACACCAGAAATAACTCGAGTTATTTCTGGTGTTGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002995.1-322s1c1
Sequence:CCGGGAACCCAGCAATCGACCAATACTCGAGTATTGGTCGATTGCTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002995.1-84s1c1
Sequence:CCGGGTAGGGAGTGAAGTCTCAGATCTCGAGATCTGAGACTTCACTCCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002995.1-178s1c1
Sequence:CCGGGCTCCTTGAGAGCAGTAATTTCTCGAGAAATTACTGCTCTCAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002995.1-66s1c1
Sequence:CCGGGCATACATTGTGGAAGGTGTACTCGAGTACACCTTCCACAATGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002995.1-653s21c1
Sequence:CCGGAGATTCTGGCTAGTGTCTATCCTCGAGGATAGACACTAGCCAGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002995.1-779s21c1
Sequence:CCGGTTCAACTTGTCTCTATAATAGCTCGAGCTATTATAGAGACAAGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002995.1-748s21c1
Sequence:CCGGGCTGTGACAATGGCAACAATTCTCGAGAATTGTTGCCATTGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002995
XCL1 MISSION shRNA shRNA Plasmid DNA
chemokine (C motif) ligand 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002995.1-278s1c1
Sequence:CCGGGAAATCCAACACCAGAAATAACTCGAGTTATTTCTGGTGTTGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002995.1-322s1c1
Sequence:CCGGGAACCCAGCAATCGACCAATACTCGAGTATTGGTCGATTGCTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002995.1-84s1c1
Sequence:CCGGGTAGGGAGTGAAGTCTCAGATCTCGAGATCTGAGACTTCACTCCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002995.1-178s1c1
Sequence:CCGGGCTCCTTGAGAGCAGTAATTTCTCGAGAAATTACTGCTCTCAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002995.1-66s1c1
Sequence:CCGGGCATACATTGTGGAAGGTGTACTCGAGTACACCTTCCACAATGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002995.1-653s21c1
Sequence:CCGGAGATTCTGGCTAGTGTCTATCCTCGAGGATAGACACTAGCCAGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002995.1-779s21c1
Sequence:CCGGTTCAACTTGTCTCTATAATAGCTCGAGCTATTATAGAGACAAGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002995.1-748s21c1
Sequence:CCGGGCTGTGACAATGGCAACAATTCTCGAGAATTGTTGCCATTGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002995
XCL1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C motif) ligand 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002995.1-278s1c1
Sequence:CCGGGAAATCCAACACCAGAAATAACTCGAGTTATTTCTGGTGTTGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002995.1-322s1c1
Sequence:CCGGGAACCCAGCAATCGACCAATACTCGAGTATTGGTCGATTGCTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002995.1-84s1c1
Sequence:CCGGGTAGGGAGTGAAGTCTCAGATCTCGAGATCTGAGACTTCACTCCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002995.1-178s1c1
Sequence:CCGGGCTCCTTGAGAGCAGTAATTTCTCGAGAAATTACTGCTCTCAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002995.1-66s1c1
Sequence:CCGGGCATACATTGTGGAAGGTGTACTCGAGTACACCTTCCACAATGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002995.1-653s21c1
Sequence:CCGGAGATTCTGGCTAGTGTCTATCCTCGAGGATAGACACTAGCCAGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002995.1-779s21c1
Sequence:CCGGTTCAACTTGTCTCTATAATAGCTCGAGCTATTATAGAGACAAGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002995.1-748s21c1
Sequence:CCGGGCTGTGACAATGGCAACAATTCTCGAGAATTGTTGCCATTGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008510
XCL1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C motif) ligand 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008510.1-226s1c1
Sequence:CCGGGTGCTGATCCAGAAGCCAAATCTCGAGATTTGGCTTCTGGATCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008510.1-91s1c1
Sequence:CCGGCTGAAGTCCTAGAAGAGAGTACTCGAGTACTCTCTTCTAGGACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008510.1-200s1c1
Sequence:CCGGTGTCACCAAACGAGGACTAAACTCGAGTTTAGTCCTCGTTTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008510.1-255s1c1
Sequence:CCGGGCAGCGATCAAGACTGTGGATCTCGAGATCCACAGTCTTGATCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008510.1-101s1c1
Sequence:CCGGAGAAGAGAGTAGCTGTGTGAACTCGAGTTCACACAGCTACTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008510.1-332s21c1
Sequence:CCGGGTCCACCAGCACAGCGATAACCTCGAGGTTATCGCTGTGCTGGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008510.1-153s21c1
Sequence:CCGGATCAAGACCTATATCATCTGGCTCGAGCCAGATGATATAGGTCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008510
XCL1 MISSION shRNA shRNA Plasmid DNA
chemokine (C motif) ligand 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008510.1-226s1c1
Sequence:CCGGGTGCTGATCCAGAAGCCAAATCTCGAGATTTGGCTTCTGGATCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008510.1-91s1c1
Sequence:CCGGCTGAAGTCCTAGAAGAGAGTACTCGAGTACTCTCTTCTAGGACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008510.1-200s1c1
Sequence:CCGGTGTCACCAAACGAGGACTAAACTCGAGTTTAGTCCTCGTTTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008510.1-255s1c1
Sequence:CCGGGCAGCGATCAAGACTGTGGATCTCGAGATCCACAGTCTTGATCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008510.1-101s1c1
Sequence:CCGGAGAAGAGAGTAGCTGTGTGAACTCGAGTTCACACAGCTACTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008510.1-332s21c1
Sequence:CCGGGTCCACCAGCACAGCGATAACCTCGAGGTTATCGCTGTGCTGGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008510.1-153s21c1
Sequence:CCGGATCAAGACCTATATCATCTGGCTCGAGCCAGATGATATAGGTCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008510
XCL1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C motif) ligand 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008510.1-226s1c1
Sequence:CCGGGTGCTGATCCAGAAGCCAAATCTCGAGATTTGGCTTCTGGATCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008510.1-91s1c1
Sequence:CCGGCTGAAGTCCTAGAAGAGAGTACTCGAGTACTCTCTTCTAGGACTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008510.1-200s1c1
Sequence:CCGGTGTCACCAAACGAGGACTAAACTCGAGTTTAGTCCTCGTTTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008510.1-255s1c1
Sequence:CCGGGCAGCGATCAAGACTGTGGATCTCGAGATCCACAGTCTTGATCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008510.1-101s1c1
Sequence:CCGGAGAAGAGAGTAGCTGTGTGAACTCGAGTTCACACAGCTACTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008510.1-332s21c1
Sequence:CCGGGTCCACCAGCACAGCGATAACCTCGAGGTTATCGCTGTGCTGGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008510.1-153s21c1
Sequence:CCGGATCAAGACCTATATCATCTGGCTCGAGCCAGATGATATAGGTCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks