EMAIL THIS PAGE TO A FRIEND

XCL2

chemokine (C motif) ligand 2

Synonyms: SCM-1b SCM1B SCYC2
Species: Human XCL2(6846), cow XCL2(100295210), domestic guinea pig Xcl2(100728044), naked mole-rat Xcl2(101716020)
UniProtKB ID: Q9UBD3
Gene ID:
cow(100295210) chemokine (C motif) ligand 2
domestic guinea pig(100728044) chemokine (C motif) ligand 2
naked mole-rat(101716020) chemokine (C motif) ligand 2
Gene Class: Cytokines_and_Chemokines
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003175 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112121 MISSION® esiRNA esiRNA human XCL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003175 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142054 predicted 277
2 SASI_Hs01_00142055 predicted 277
3 SASI_Hs01_00142057 predicted 316
4 SASI_Hs01_00142058 predicted 233
5 SASI_Hs01_00142059 predicted 290
6 SASI_Hs01_00142060 predicted 298
7 SASI_Hs01_00142061 predicted 250
8 SASI_Hs02_00335198 predicted 288
9 SASI_Hs01_00142062 predicted 291
10 SASI_Hs01_00142063 predicted 294
11 SASI_Hs01_00142056 predicted 274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003175
XCL2 MISSION shRNA Bacterial Glycerol Stock
chemokine (C motif) ligand 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003175.3-462s21c1
Sequence:CCGGATGAAAGCACTGCATGAATAACTCGAGTTATTCATGCAGTGCTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003175.3-190s21c1
Sequence:CCGGGGCTCCTTGAGAGCAGTAATTCTCGAGAATTACTGCTCTCAAGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003175.2-137s1c1
Sequence:CCGGACTGCCAGTTAGCAGAATCAACTCGAGTTGATTCTGCTAACTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003175.2-53s1c1
Sequence:CCGGCTGCTCTCTCACTGCATACATCTCGAGATGTATGCAGTGAGAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003175.2-149s1c1
Sequence:CCGGCAGAATCAAGACCTACACCATCTCGAGATGGTGTAGGTCTTGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003175.2-284s1c1
Sequence:CCGGCAACACCAGAAATAACATGATCTCGAGATCATGTTATTTCTGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003175.2-84s1c1
Sequence:CCGGGTAGGGAGTGAAGTCTCACATCTCGAGATGTGAGACTTCACTCCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003175
XCL2 MISSION shRNA shRNA Plasmid DNA
chemokine (C motif) ligand 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003175.3-462s21c1
Sequence:CCGGATGAAAGCACTGCATGAATAACTCGAGTTATTCATGCAGTGCTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003175.3-190s21c1
Sequence:CCGGGGCTCCTTGAGAGCAGTAATTCTCGAGAATTACTGCTCTCAAGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003175.2-137s1c1
Sequence:CCGGACTGCCAGTTAGCAGAATCAACTCGAGTTGATTCTGCTAACTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003175.2-53s1c1
Sequence:CCGGCTGCTCTCTCACTGCATACATCTCGAGATGTATGCAGTGAGAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003175.2-149s1c1
Sequence:CCGGCAGAATCAAGACCTACACCATCTCGAGATGGTGTAGGTCTTGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003175.2-284s1c1
Sequence:CCGGCAACACCAGAAATAACATGATCTCGAGATCATGTTATTTCTGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003175.2-84s1c1
Sequence:CCGGGTAGGGAGTGAAGTCTCACATCTCGAGATGTGAGACTTCACTCCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003175
XCL2 MISSION shRNA Lentiviral Transduction Particles
chemokine (C motif) ligand 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003175.3-462s21c1
Sequence:CCGGATGAAAGCACTGCATGAATAACTCGAGTTATTCATGCAGTGCTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003175.3-190s21c1
Sequence:CCGGGGCTCCTTGAGAGCAGTAATTCTCGAGAATTACTGCTCTCAAGGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003175.2-137s1c1
Sequence:CCGGACTGCCAGTTAGCAGAATCAACTCGAGTTGATTCTGCTAACTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003175.2-53s1c1
Sequence:CCGGCTGCTCTCTCACTGCATACATCTCGAGATGTATGCAGTGAGAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003175.2-149s1c1
Sequence:CCGGCAGAATCAAGACCTACACCATCTCGAGATGGTGTAGGTCTTGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003175.2-284s1c1
Sequence:CCGGCAACACCAGAAATAACATGATCTCGAGATCATGTTATTTCTGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003175.2-84s1c1
Sequence:CCGGGTAGGGAGTGAAGTCTCACATCTCGAGATGTGAGACTTCACTCCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks