EMAIL THIS PAGE TO A FRIEND

XCR1

chemokine (C motif) receptor 1

Synonyms: CCXCR1 GPR5
UniProtKB ID: P46094
Gene ID:
Human(2829) Summary: The protein encoded by this gene is a chemokine receptor belonging to the G protein-coupled receptor superfamily. The family members are characterized by the presence of 7 transmembrane domains and numerous conserved amino acids. This receptor is most closely related to RBS11 and the MIP1-alpha/RANTES receptor. It transduces a signal by increasing the intracellular calcium ions level. The viral macrophage inflammatory protein-II is an antagonist of this receptor and blocks signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(23832) chemokine (C motif) receptor 1
Rat(301086) chemokine (C motif) receptor 1
chicken(428452) chemokine (C motif) receptor 1
domestic cat(101083750) chemokine (C motif) receptor 1
dog(484792) chemokine (C motif) receptor 1
naked mole-rat(101725439) chemokine (C motif) receptor 1
cow(617880) chemokine (C motif) receptor 1
sheep(101118228) chemokine (C motif) receptor 1
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011798 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011798 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011798 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005283 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU019361 MISSION® esiRNA esiRNA targeting mouse Xcr1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024644 Rosetta Predictions human pricing
NM_005283 Rosetta Predictions human pricing
NM_001106871 Rosetta Predictions rat pricing
NM_011798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107913 predicted 880
2 SASI_Hs01_00107914 predicted 631
3 SASI_Hs01_00107915 predicted 826
4 SASI_Hs01_00107916 predicted 638
5 SASI_Hs01_00107917 predicted 607
6 SASI_Hs01_00107918 predicted 571
7 SASI_Hs01_00107919 predicted 393
8 SASI_Hs01_00107920 predicted 280
9 SASI_Hs01_00107922 predicted 815
10 SASI_Hs01_00107921 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217173 predicted 1003
2 SASI_Hs01_00217174 predicted 756
3 SASI_Hs01_00217175 predicted 949
4 SASI_Hs01_00217176 predicted 763
5 SASI_Hs01_00217177 predicted 729
6 SASI_Hs01_00217178 predicted 694
7 SASI_Hs01_00217179 predicted 515
8 SASI_Hs01_00217180 predicted 398
9 SASI_Hs01_00217182 predicted 932
10 SASI_Hs01_00217181 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223226 predicted 929
2 SASI_Rn02_00223227 predicted 562
3 SASI_Rn02_00223228 predicted 1019
4 SASI_Rn02_00223229 predicted 602
5 SASI_Rn02_00223230 predicted 818
6 SASI_Rn02_00223231 predicted 1168
7 SASI_Rn02_00223232 predicted 718
8 SASI_Rn02_00223233 predicted 894
9 SASI_Rn02_00223234 predicted 587
10 SASI_Rn02_00223235 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321466 predicted 384
2 SASI_Mm02_00321467 predicted 300
3 SASI_Mm02_00321468 predicted 704
4 SASI_Mm02_00321469 predicted 409
5 SASI_Mm02_00321470 predicted 694
6 SASI_Mm02_00321471 predicted 932
7 SASI_Mm02_00321472 predicted 720
8 SASI_Mm02_00321473 predicted 505
9 SASI_Mm02_00321474 predicted 968
10 SASI_Mm02_00321475 predicted 653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011798
XCR1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C motif) receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011798.2-406s1c1
Sequence:CCGGCTTCTGCAAGTTCTTCAACATCTCGAGATGTTGAAGAACTTGCAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011798.2-607s1c1
Sequence:CCGGCCACAAAGTGATCTCCTTAAACTCGAGTTTAAGGAGATCACTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011798.2-709s1c1
Sequence:CCGGCCTATTCTGTTATGTACAGATCTCGAGATCTGTACATAACAGAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011798.2-947s1c1
Sequence:CCGGCCAGTGCTTTATGTCTTTGTTCTCGAGAACAAAGACATAAAGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011798.2-899s1c1
Sequence:CCGGGCTATGATTATCTGTCGCCATCTCGAGATGGCGACAGATAATCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011798
XCR1 MISSION shRNA shRNA Plasmid DNA
chemokine (C motif) receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011798.2-406s1c1
Sequence:CCGGCTTCTGCAAGTTCTTCAACATCTCGAGATGTTGAAGAACTTGCAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011798.2-607s1c1
Sequence:CCGGCCACAAAGTGATCTCCTTAAACTCGAGTTTAAGGAGATCACTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011798.2-709s1c1
Sequence:CCGGCCTATTCTGTTATGTACAGATCTCGAGATCTGTACATAACAGAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011798.2-947s1c1
Sequence:CCGGCCAGTGCTTTATGTCTTTGTTCTCGAGAACAAAGACATAAAGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011798.2-899s1c1
Sequence:CCGGGCTATGATTATCTGTCGCCATCTCGAGATGGCGACAGATAATCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011798
XCR1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C motif) receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011798.2-406s1c1
Sequence:CCGGCTTCTGCAAGTTCTTCAACATCTCGAGATGTTGAAGAACTTGCAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011798.2-607s1c1
Sequence:CCGGCCACAAAGTGATCTCCTTAAACTCGAGTTTAAGGAGATCACTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011798.2-709s1c1
Sequence:CCGGCCTATTCTGTTATGTACAGATCTCGAGATCTGTACATAACAGAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011798.2-947s1c1
Sequence:CCGGCCAGTGCTTTATGTCTTTGTTCTCGAGAACAAAGACATAAAGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011798.2-899s1c1
Sequence:CCGGGCTATGATTATCTGTCGCCATCTCGAGATGGCGACAGATAATCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005283
XCR1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C motif) receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005283.1-521s1c1
Sequence:CCGGGCTGTGATTATTCCGAACTCACTCGAGTGAGTTCGGAATAATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005283.1-718s1c1
Sequence:CCGGCCCTACAACTTCACCCTGTTTCTCGAGAAACAGGGTGAAGTTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005283.1-312s1c1
Sequence:CCGGCCTCAATATGATCTTCTCCATCTCGAGATGGAGAAGATCATATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005283.1-93s1c1
Sequence:CCGGCCTCGCCACCACTGTCCTGTACTCGAGTACAGGACAGTGGTGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005283.1-300s1c1
Sequence:CCGGCCTCTGCAAACTCCTCAATATCTCGAGATATTGAGGAGTTTGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005283.2-523s21c1
Sequence:CCGGTCCTCTGCAAACTCCTCAATACTCGAGTATTGAGGAGTTTGCAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005283.2-737s21c1
Sequence:CCGGTTCTTCGGGCTGTGATTATTCCTCGAGGAATAATCACAGCCCGAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005283.2-1004s21c1
Sequence:CCGGGGCCAAACAGCAGCTAGAATACTCGAGTATTCTAGCTGCTGTTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005283
XCR1 MISSION shRNA shRNA Plasmid DNA
chemokine (C motif) receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005283.1-521s1c1
Sequence:CCGGGCTGTGATTATTCCGAACTCACTCGAGTGAGTTCGGAATAATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005283.1-718s1c1
Sequence:CCGGCCCTACAACTTCACCCTGTTTCTCGAGAAACAGGGTGAAGTTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005283.1-312s1c1
Sequence:CCGGCCTCAATATGATCTTCTCCATCTCGAGATGGAGAAGATCATATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005283.1-93s1c1
Sequence:CCGGCCTCGCCACCACTGTCCTGTACTCGAGTACAGGACAGTGGTGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005283.1-300s1c1
Sequence:CCGGCCTCTGCAAACTCCTCAATATCTCGAGATATTGAGGAGTTTGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005283.2-523s21c1
Sequence:CCGGTCCTCTGCAAACTCCTCAATACTCGAGTATTGAGGAGTTTGCAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005283.2-737s21c1
Sequence:CCGGTTCTTCGGGCTGTGATTATTCCTCGAGGAATAATCACAGCCCGAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005283.2-1004s21c1
Sequence:CCGGGGCCAAACAGCAGCTAGAATACTCGAGTATTCTAGCTGCTGTTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005283
XCR1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C motif) receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005283.1-521s1c1
Sequence:CCGGGCTGTGATTATTCCGAACTCACTCGAGTGAGTTCGGAATAATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005283.1-718s1c1
Sequence:CCGGCCCTACAACTTCACCCTGTTTCTCGAGAAACAGGGTGAAGTTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005283.1-312s1c1
Sequence:CCGGCCTCAATATGATCTTCTCCATCTCGAGATGGAGAAGATCATATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005283.1-93s1c1
Sequence:CCGGCCTCGCCACCACTGTCCTGTACTCGAGTACAGGACAGTGGTGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005283.1-300s1c1
Sequence:CCGGCCTCTGCAAACTCCTCAATATCTCGAGATATTGAGGAGTTTGCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005283.2-523s21c1
Sequence:CCGGTCCTCTGCAAACTCCTCAATACTCGAGTATTGAGGAGTTTGCAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005283.2-737s21c1
Sequence:CCGGTTCTTCGGGCTGTGATTATTCCTCGAGGAATAATCACAGCCCGAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005283.2-1004s21c1
Sequence:CCGGGGCCAAACAGCAGCTAGAATACTCGAGTATTCTAGCTGCTGTTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks