EMAIL THIS PAGE TO A FRIEND

XDH

xanthine dehydrogenase

Synonyms: XO XOR
UniProtKB ID: P47989, Q16681, Q16712, Q4PJ16
Gene ID:
Human(7498) Summary: Xanthine dehydrogenase belongs to the group of molybdenum-containing hydroxylases involved in the oxidative metabolism of purines. The enzyme is a homodimer. Xanthine dehydrogenase can be converted to xanthine oxidase by reversible sulfhydryl oxidation or by irreversible proteolytic modification. Defects in xanthine dehydrogenase cause xanthinuria, may contribute to adult respiratory stress syndrome, and may potentiate influenza infection through an oxygen metabolite-dependent mechanism. [provided by RefSeq, Jul 2008]
Mouse(22436) xanthine dehydrogenase
Rat(497811) xanthine dehydrogenase
Zebrafish(560486) xanthine dehydrogenase
chicken(396025) xanthine dehydrogenase
domestic cat(493692) xanthine dehydrogenase
dog(483028) xanthine dehydrogenase
cow(280960) xanthine dehydrogenase
sheep(780499) xanthine dehydrogenase
Goat(100861280) xanthine dehydrogenase
domestic guinea pig(100731391) xanthine dehydrogenase
naked mole-rat(101708017) xanthine dehydrogenase
124 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A8003 Allopurinol xanthine oxidase inhibitor human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000379 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011723 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011723 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011723 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000379 Rosetta Predictions human pricing
NM_017154 Rosetta Predictions rat pricing
XM_579397 Rosetta Predictions rat pricing
NM_011723 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021371 predicted 3003
2 SASI_Hs01_00021372 predicted 2058
3 SASI_Hs01_00021373 predicted 1711
4 SASI_Hs01_00021374 predicted 3453
5 SASI_Hs02_00302438 predicted 3633
6 SASI_Hs02_00302439 predicted 3621
7 SASI_Hs01_00021376 predicted 3356
8 SASI_Hs01_00021377 predicted 2149
9 SASI_Hs01_00021378 predicted 3069
10 SASI_Hs01_00021379 predicted 2174
11 SASI_Hs01_00021370 predicted 3134
12 SASI_Hs01_00021375 predicted 1955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109350 predicted 2941
2 SASI_Rn01_00109352 predicted 3459
3 SASI_Rn01_00109353 predicted 2378
4 SASI_Rn01_00109354 predicted 3192
5 SASI_Rn01_00109355 predicted 3562
6 SASI_Rn01_00109356 predicted 559
7 SASI_Rn01_00109357 predicted 3383
8 SASI_Rn01_00109358 predicted 569
9 SASI_Rn01_00109359 predicted 3277
10 SASI_Rn02_00261447 predicted 3925
11 SASI_Rn01_00109351 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00188090 predicted 2946
2 SASI_Rn01_00188091 predicted 906
3 SASI_Rn01_00188092 predicted 2174
4 SASI_Rn01_00188093 predicted 436
5 SASI_Rn01_00188094 predicted 565
6 SASI_Rn01_00188095 predicted 381
7 SASI_Rn01_00188096 predicted 548
8 SASI_Rn01_00188097 predicted 2100
9 SASI_Rn01_00188098 predicted 576
10 SASI_Rn01_00188099 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081651 predicted 3262
2 SASI_Mm02_00321291 predicted 585
3 SASI_Mm01_00081652 predicted 340
4 SASI_Mm01_00081653 predicted 3960
5 SASI_Mm01_00081654 predicted 3601
6 SASI_Mm01_00081655 predicted 3615
7 SASI_Mm01_00081656 predicted 3078
8 SASI_Mm01_00081657 predicted 2821
9 SASI_Mm01_00081658 predicted 4117
10 SASI_Mm01_00081659 predicted 3781
11 SASI_Mm01_00081660 predicted 628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000379
XDH MISSION shRNA Bacterial Glycerol Stock
xanthine dehydrogenase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000379.3-3336s21c1
Sequence:CCGGTCAATGGACAGGCCGTCTATGCTCGAGCATAGACGGCCTGTCCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000379.3-4149s21c1
Sequence:CCGCACAGAACATGGATCTATTAAACTCGAGTTTAATAGATCCATGTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000379.3-4538s21c1
Sequence:CCGGACCTTGAATCTATACTCAAATCTCGAGATTTGAGTATAGATTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000379.2-2185s1c1
Sequence:CCGGGCTATAAAGAACAACTCCTTTCTCGAGAAAGGAGTTGTTCTTTATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000379.2-1717s1c1
Sequence:CCGGGCAACTTTACTGTTTCAGAAACTCGAGTTTCTGAAACAGTAAAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000379.2-1927s1c1
Sequence:CCGGGCCAAGATCAAGTCCATAGATCTCGAGATCTATGGACTTGATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000379.2-3936s1c1
Sequence:CCGGGCACACAGGTAATAACGTGAACTCGAGTTCACGTTATTACCTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000379.2-2694s1c1
Sequence:CCGGCCAGGATCTCTCTCAGAGTATCTCGAGATACTCTGAGAGAGATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000379
XDH MISSION shRNA shRNA Plasmid DNA
xanthine dehydrogenase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000379.3-3336s21c1
Sequence:CCGGTCAATGGACAGGCCGTCTATGCTCGAGCATAGACGGCCTGTCCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000379.3-4149s21c1
Sequence:CCGCACAGAACATGGATCTATTAAACTCGAGTTTAATAGATCCATGTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000379.3-4538s21c1
Sequence:CCGGACCTTGAATCTATACTCAAATCTCGAGATTTGAGTATAGATTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000379.2-2185s1c1
Sequence:CCGGGCTATAAAGAACAACTCCTTTCTCGAGAAAGGAGTTGTTCTTTATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000379.2-1717s1c1
Sequence:CCGGGCAACTTTACTGTTTCAGAAACTCGAGTTTCTGAAACAGTAAAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000379.2-1927s1c1
Sequence:CCGGGCCAAGATCAAGTCCATAGATCTCGAGATCTATGGACTTGATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000379.2-3936s1c1
Sequence:CCGGGCACACAGGTAATAACGTGAACTCGAGTTCACGTTATTACCTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000379.2-2694s1c1
Sequence:CCGGCCAGGATCTCTCTCAGAGTATCTCGAGATACTCTGAGAGAGATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000379
XDH MISSION shRNA Lentiviral Transduction Particles
xanthine dehydrogenase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000379.3-3336s21c1
Sequence:CCGGTCAATGGACAGGCCGTCTATGCTCGAGCATAGACGGCCTGTCCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000379.3-4149s21c1
Sequence:CCGCACAGAACATGGATCTATTAAACTCGAGTTTAATAGATCCATGTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000379.3-4538s21c1
Sequence:CCGGACCTTGAATCTATACTCAAATCTCGAGATTTGAGTATAGATTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000379.2-2185s1c1
Sequence:CCGGGCTATAAAGAACAACTCCTTTCTCGAGAAAGGAGTTGTTCTTTATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000379.2-1717s1c1
Sequence:CCGGGCAACTTTACTGTTTCAGAAACTCGAGTTTCTGAAACAGTAAAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000379.2-1927s1c1
Sequence:CCGGGCCAAGATCAAGTCCATAGATCTCGAGATCTATGGACTTGATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000379.2-3936s1c1
Sequence:CCGGGCACACAGGTAATAACGTGAACTCGAGTTCACGTTATTACCTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000379.2-2694s1c1
Sequence:CCGGCCAGGATCTCTCTCAGAGTATCTCGAGATACTCTGAGAGAGATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011723
VALIDATED
XDH MISSION shRNA Bacterial Glycerol Stock
xanthine dehydrogenase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011723.2-2754s21c1
Sequence:CCGGCGGGAGGATTTGTAAGACTAACTCGAGTTAGTCTTACAAATCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011723.2-241s21c1
Sequence:CCGGCGCCTTCAGAACAAGATCGTTCTCGAGAACGATCTTGTTCTGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011723.2-2676s21c1
Sequence:CCGGGGATCTCTCTCGGAGTATAATCTCGAGATTATACTCCGAGAGAGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011723.2-2151s21c1
Sequence:CCGGCACAATCCAGGATGCTATAAACTCGAGTTTATAGCATCCTGGATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319662    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011723.2-4265s21c1
Sequence:CCGGTTGAGTAATTCTGGGTAATTCCTCGAGGAATTACCCAGAATTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011723.1-2725s1c1
Sequence:CCGGCGGGAGGATTTGTAAGACTAACTCGAGTTAGTCTTACAAATCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011723.1-212s1c1
Sequence:CCGGCGCCTTCAGAACAAGATCGTTCTCGAGAACGATCTTGTTCTGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011723.1-3588s1c1
Sequence:CCGGGCTTGAATCCTGCCATTGATACTCGAGTATCAATGGCAGGATTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011723.1-622s1c1
Sequence:CCGGCCCGGAGGATTTCAAACCTTTCTCGAGAAAGGTTTGAAATCCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011723.1-3025s1c1
Sequence:CCGGGCTGTGTATAATCCCGACTAACTCGAGTTAGTCGGGATTATACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011723
VALIDATED
XDH MISSION shRNA shRNA Plasmid DNA
xanthine dehydrogenase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011723.2-2754s21c1
Sequence:CCGGCGGGAGGATTTGTAAGACTAACTCGAGTTAGTCTTACAAATCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011723.2-241s21c1
Sequence:CCGGCGCCTTCAGAACAAGATCGTTCTCGAGAACGATCTTGTTCTGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011723.2-2676s21c1
Sequence:CCGGGGATCTCTCTCGGAGTATAATCTCGAGATTATACTCCGAGAGAGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011723.2-2151s21c1
Sequence:CCGGCACAATCCAGGATGCTATAAACTCGAGTTTATAGCATCCTGGATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319662    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011723.2-4265s21c1
Sequence:CCGGTTGAGTAATTCTGGGTAATTCCTCGAGGAATTACCCAGAATTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011723.1-2725s1c1
Sequence:CCGGCGGGAGGATTTGTAAGACTAACTCGAGTTAGTCTTACAAATCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011723.1-212s1c1
Sequence:CCGGCGCCTTCAGAACAAGATCGTTCTCGAGAACGATCTTGTTCTGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011723.1-3588s1c1
Sequence:CCGGGCTTGAATCCTGCCATTGATACTCGAGTATCAATGGCAGGATTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011723.1-622s1c1
Sequence:CCGGCCCGGAGGATTTCAAACCTTTCTCGAGAAAGGTTTGAAATCCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011723.1-3025s1c1
Sequence:CCGGGCTGTGTATAATCCCGACTAACTCGAGTTAGTCGGGATTATACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011723
VALIDATED
XDH MISSION shRNA Lentiviral Transduction Particles
xanthine dehydrogenase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011723.2-2754s21c1
Sequence:CCGGCGGGAGGATTTGTAAGACTAACTCGAGTTAGTCTTACAAATCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011723.2-241s21c1
Sequence:CCGGCGCCTTCAGAACAAGATCGTTCTCGAGAACGATCTTGTTCTGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011723.2-2676s21c1
Sequence:CCGGGGATCTCTCTCGGAGTATAATCTCGAGATTATACTCCGAGAGAGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011723.2-2151s21c1
Sequence:CCGGCACAATCCAGGATGCTATAAACTCGAGTTTATAGCATCCTGGATTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319662    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011723.2-4265s21c1
Sequence:CCGGTTGAGTAATTCTGGGTAATTCCTCGAGGAATTACCCAGAATTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011723.1-2725s1c1
Sequence:CCGGCGGGAGGATTTGTAAGACTAACTCGAGTTAGTCTTACAAATCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011723.1-212s1c1
Sequence:CCGGCGCCTTCAGAACAAGATCGTTCTCGAGAACGATCTTGTTCTGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011723.1-3588s1c1
Sequence:CCGGGCTTGAATCCTGCCATTGATACTCGAGTATCAATGGCAGGATTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011723.1-622s1c1
Sequence:CCGGCCCGGAGGATTTCAAACCTTTCTCGAGAAAGGTTTGAAATCCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011723.1-3025s1c1
Sequence:CCGGGCTGTGTATAATCCCGACTAACTCGAGTTAGTCGGGATTATACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks