EMAIL THIS PAGE TO A FRIEND

XG

Xg blood group

Synonyms: PBDX
UniProtKB ID: P55808, E9PCH1, Q496N8, Q496N9, Q496P0, Q71BZ5
Gene ID:
Human(7499) Summary: This gene encodes the XG blood group antigen, and is located at the pseudoautosomal boundary on the short (p) arm of chromosome X. The three 5' exons reside in the pseudoautosomal region and the remaining exons within the X-specific end. A truncated copy of this gene is found on the Y chromosome at the pseudoautosomal boundary. It is transcribed, but not expected to make a Y-chromosome specific gene product. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
chicken(418661) Xg blood group
dog(609839) Xg blood group
cow(101902671) Xg blood group
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA021539 Anti-XG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175569 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110061 MISSION® esiRNA esiRNA human XG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175569 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113035 predicted 537
2 SASI_Hs01_00113036 predicted 828
3 SASI_Hs01_00113037 predicted 1224
4 SASI_Hs02_00368996 predicted 796
5 SASI_Hs01_00113038 predicted 974
6 SASI_Hs01_00113039 predicted 444
7 SASI_Hs01_00113040 predicted 1136
8 SASI_Hs01_00113041 predicted 1020
9 SASI_Hs01_00113042 predicted 348
10 SASI_Hs01_00113043 predicted 1150
11 SASI_Hs01_00113034 predicted 906
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175569
VALIDATED
XG MISSION shRNA Bacterial Glycerol Stock
Xg blood group
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175569.1-1745s1c1
Sequence:CCGGGCCATAAATATCAGAACCAAACTCGAGTTTGGTTCTGATATTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175569.1-606s1c1
Sequence:CCGGAGAAGGCAATATGGTAGCAAACTCGAGTTTGCTACCATATTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175569.1-676s1c1
Sequence:CCGGGCAGCCAGTTATTTCAAACTACTCGAGTAGTTTGAAATAACTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175569.1-259s1c1
Sequence:CCGGCGAGGTCAAAGAGACTTTGATCTCGAGATCAAAGTCTCTTTGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175569.1-383s1c1
Sequence:CCGGGCGGTGGAAATATCTACCCAACTCGAGTTGGGTAGATATTTCCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175569.2-594s21c1
Sequence:CCGGACGGTGGAGATCACCATTCAACTCGAGTTGAATGGTGATCTCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175569.2-943s21c1
Sequence:CCGGGTGGTTATAAAGATAAGTTAGCTCGAGCTAACTTATCTTTATAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175569.2-468s21c1
Sequence:CCGGACAGTGGAGGTTACTTCAATGCTCGAGCATTGAAGTAACCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175569.2-397s21c1
Sequence:CCGGTCCCGACAGCGGTGGAAATATCTCGAGATATTTCCACCGCTGTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175569.2-966s21c1
Sequence:CCGGAGCTAGACCCTGCGTTCTAAACTCGAGTTTAGAACGCAGGGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175569.2-334s21c1
Sequence:CCGGCAAGAAGCCAAACTCAGATATCTCGAGATATCTGAGTTTGGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175569.2-691s21c1
Sequence:CCGGGGGAGCAGCAGCCAGTTATTTCTCGAGAAATAACTGGCTGCTGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175569.2-620s21c1
Sequence:CCGGGGCAATCCAGAAGGCAATATGCTCGAGCATATTGCCTTCTGGATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175569
VALIDATED
XG MISSION shRNA shRNA Plasmid DNA
Xg blood group
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175569.1-1745s1c1
Sequence:CCGGGCCATAAATATCAGAACCAAACTCGAGTTTGGTTCTGATATTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175569.1-606s1c1
Sequence:CCGGAGAAGGCAATATGGTAGCAAACTCGAGTTTGCTACCATATTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175569.1-676s1c1
Sequence:CCGGGCAGCCAGTTATTTCAAACTACTCGAGTAGTTTGAAATAACTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175569.1-259s1c1
Sequence:CCGGCGAGGTCAAAGAGACTTTGATCTCGAGATCAAAGTCTCTTTGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175569.1-383s1c1
Sequence:CCGGGCGGTGGAAATATCTACCCAACTCGAGTTGGGTAGATATTTCCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175569.2-594s21c1
Sequence:CCGGACGGTGGAGATCACCATTCAACTCGAGTTGAATGGTGATCTCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175569.2-943s21c1
Sequence:CCGGGTGGTTATAAAGATAAGTTAGCTCGAGCTAACTTATCTTTATAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175569.2-468s21c1
Sequence:CCGGACAGTGGAGGTTACTTCAATGCTCGAGCATTGAAGTAACCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175569.2-397s21c1
Sequence:CCGGTCCCGACAGCGGTGGAAATATCTCGAGATATTTCCACCGCTGTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175569.2-966s21c1
Sequence:CCGGAGCTAGACCCTGCGTTCTAAACTCGAGTTTAGAACGCAGGGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175569.2-334s21c1
Sequence:CCGGCAAGAAGCCAAACTCAGATATCTCGAGATATCTGAGTTTGGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175569.2-691s21c1
Sequence:CCGGGGGAGCAGCAGCCAGTTATTTCTCGAGAAATAACTGGCTGCTGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175569.2-620s21c1
Sequence:CCGGGGCAATCCAGAAGGCAATATGCTCGAGCATATTGCCTTCTGGATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175569
VALIDATED
XG MISSION shRNA Lentiviral Transduction Particles
Xg blood group
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175569.1-1745s1c1
Sequence:CCGGGCCATAAATATCAGAACCAAACTCGAGTTTGGTTCTGATATTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175569.1-606s1c1
Sequence:CCGGAGAAGGCAATATGGTAGCAAACTCGAGTTTGCTACCATATTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_175569.1-676s1c1
Sequence:CCGGGCAGCCAGTTATTTCAAACTACTCGAGTAGTTTGAAATAACTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175569.1-259s1c1
Sequence:CCGGCGAGGTCAAAGAGACTTTGATCTCGAGATCAAAGTCTCTTTGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175569.1-383s1c1
Sequence:CCGGGCGGTGGAAATATCTACCCAACTCGAGTTGGGTAGATATTTCCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175569.2-594s21c1
Sequence:CCGGACGGTGGAGATCACCATTCAACTCGAGTTGAATGGTGATCTCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175569.2-943s21c1
Sequence:CCGGGTGGTTATAAAGATAAGTTAGCTCGAGCTAACTTATCTTTATAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175569.2-468s21c1
Sequence:CCGGACAGTGGAGGTTACTTCAATGCTCGAGCATTGAAGTAACCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175569.2-397s21c1
Sequence:CCGGTCCCGACAGCGGTGGAAATATCTCGAGATATTTCCACCGCTGTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175569.2-966s21c1
Sequence:CCGGAGCTAGACCCTGCGTTCTAAACTCGAGTTTAGAACGCAGGGTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175569.2-334s21c1
Sequence:CCGGCAAGAAGCCAAACTCAGATATCTCGAGATATCTGAGTTTGGCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_175569.2-691s21c1
Sequence:CCGGGGGAGCAGCAGCCAGTTATTTCTCGAGAAATAACTGGCTGCTGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175569.2-620s21c1
Sequence:CCGGGGCAATCCAGAAGGCAATATGCTCGAGCATATTGCCTTCTGGATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks