EMAIL THIS PAGE TO A FRIEND

XIAP

X-linked inhibitor of apoptosis

Synonyms: API3 BIRC4 IAP-3 ILP1 MIHA XLP2 hIAP-3 hIAP3
UniProtKB ID: P98170, D3DTF2, Q9NQ14
Gene ID:
Human(331) Summary: This gene encodes a protein that belongs to a family of apoptotic suppressor proteins. Members of this family share a conserved motif termed, baculovirus IAP repeat, which is necessary for their anti-apoptotic function. This protein functions through binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2 and inhibits apoptosis induced by menadione, a potent inducer of free radicals, and interleukin 1-beta converting enzyme. This protein also inhibits at least two members of the caspase family of cell-death proteases, caspase-3 and caspase-7. Mutations in this gene are the cause of X-linked lymphoproliferative syndrome. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 2 and 11.[provided by RefSeq, Feb 2011]
Mouse(11798) X-linked inhibitor of apoptosis
Rat(63879) X-linked inhibitor of apoptosis
Zebrafish(373108) X-linked inhibitor of apoptosis
domestic cat(101090594) X-linked inhibitor of apoptosis
Horse(100060870) X-linked inhibitor of apoptosis
dog(442989) X-linked inhibitor of apoptosis
chicken(395280) X-linked inhibitor of apoptosis
domestic guinea pig(100715778) X-linked inhibitor of apoptosis
naked mole-rat(101715865) X-linked inhibitor of apoptosis
Domestic Rabbit(100328700) X-linked inhibitor of apoptosis
cow(281647) X-linked inhibitor of apoptosis
sheep(101116381) X-linked inhibitor of apoptosis
281 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405469 Anti-BIRC4 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1411890 ANTI-BIRC4 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA042129 Anti-BIRC8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA042521 Anti-BIRC8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4504010 Anti-phospho-XIAP (pSer87) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301454 Anti-phospho-XIAP (pSer87) antibody produced in rabbit affinity isolated antibody human
western blot pricing
X4503 Anti-XIAP antibody produced in goat affinity isolated antibody, lyophilized powder mouse, human, rat
western blot pricing
PRS3331 Anti-XIAP antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA042428 Anti-XIAP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4501453 Anti-XIAP antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
X3878 Anti-XRCC2 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension rodent, human
immunohistochemistry, western blot pricing
WH0000331M1 Monoclonal Anti-BIRC4 antibody produced in mouse clone 2B3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403557 Monoclonal Anti-BIRC4 antibody produced in mouse clone 1F4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
E1406 Embelin ≥98% (HPLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009688 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009688 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009688 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001167 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001167 Rosetta Predictions human pricing
NM_022231 Rosetta Predictions rat pricing
NM_009688 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331284 predicted 615
2 SASI_Hs01_00175694 predicted 608
3 SASI_Hs01_00175695 predicted 1061
4 SASI_Hs02_00331285 predicted 1383
5 SASI_Hs01_00175697 predicted 313
6 SASI_Hs01_00175698 predicted 1319
7 SASI_Hs02_00331286 predicted 1043
8 SASI_Hs01_00175701 predicted 1220
9 SASI_Hs01_00175702 predicted 915
10 SASI_Hs02_00331287 predicted 1115
11 SASI_Hs01_00175696 predicted 1394
12 SASI_Hs01_00175699 predicted 1335
13 SASI_Hs01_00175700 predicted 525
14 SASI_Hs01_00175703 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096773 predicted 1523
2 SASI_Rn01_00096774 predicted 1283
3 SASI_Rn01_00096775 predicted 585
4 SASI_Rn02_00262997 predicted 383
5 SASI_Rn01_00096778 predicted 1456
6 SASI_Rn01_00096779 predicted 593
7 SASI_Rn01_00096780 predicted 1681
8 SASI_Rn02_00262998 predicted 1060
9 SASI_Rn01_00096782 predicted 1854
10 SASI_Rn02_00262999 predicted 394
11 SASI_Rn01_00096776 predicted 1661
12 SASI_Rn01_00096777 predicted 1867
13 SASI_Rn01_00096781 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172976 predicted 579
2 SASI_Mm01_00172977 predicted 1147
3 SASI_Mm02_00316773 predicted 1876
4 SASI_Mm02_00316774 predicted 1406
5 SASI_Mm01_00172982 predicted 639
6 SASI_Mm02_00316775 predicted 1901
7 SASI_Mm02_00316776 predicted 1700
8 SASI_Mm01_00172983 predicted 564
9 SASI_Mm01_00172984 predicted 639
10 SASI_Mm02_00316777 predicted 1940
11 SASI_Mm01_00172978 predicted 1824
12 SASI_Mm01_00172979 predicted 1309
13 SASI_Mm01_00172980 predicted 1169
14 SASI_Mm01_00172981 predicted 1827
15 SASI_Mm01_00172985 predicted 1538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009688
VALIDATED
XIAP MISSION shRNA Bacterial Glycerol Stock
X-linked inhibitor of apoptosis
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009688.2-820s21c1
Sequence:CCGGAGATATTTCAGACACCATATACTCGAGTATATGGTGTCTGAAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009688.2-1821s21c1
Sequence:CCGGCCATGTGCTACACCGTCATTACTCGAGTAATGACGGTGTAGCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009688.2-896s21c1
Sequence:CCGGTGGCCGGACTATGCTCATTTACTCGAGTAAATGAGCATAGTCCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009688.2-1989s21c1
Sequence:CCGGACAGCACTGTTTCCGTCTAAACTCGAGTTTAGACGGAAACAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009688.2-1573s21c1
Sequence:CCGGATCCGGGAGCAGCTATCTATCCTCGAGGATAGATAGCTGCTCCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009688.1-2233s1c1
Sequence:CCGGGCATTTGCATTCCATTAGCATCTCGAGATGCTAATGGAATGCAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009688.1-1539s1c1
Sequence:CCGGGCTTTAGGTGAAGGCGATAAACTCGAGTTTATCGCCTTCACCTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009688.1-876s1c1
Sequence:CCGGGCAATAGATAGATGGCAGTATCTCGAGATACTGCCATCTATCTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009688.1-1702s1c1
Sequence:CCGGCCCATCCACTTGAGGAATCTTCTCGAGAAGATTCCTCAAGTGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009688.1-2125s1c1
Sequence:CCGGCCGTCATTACGTTCAACCAAACTCGAGTTTGGTTGAACGTAATGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009688
VALIDATED
XIAP MISSION shRNA shRNA Plasmid DNA
X-linked inhibitor of apoptosis
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009688.2-820s21c1
Sequence:CCGGAGATATTTCAGACACCATATACTCGAGTATATGGTGTCTGAAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009688.2-1821s21c1
Sequence:CCGGCCATGTGCTACACCGTCATTACTCGAGTAATGACGGTGTAGCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009688.2-896s21c1
Sequence:CCGGTGGCCGGACTATGCTCATTTACTCGAGTAAATGAGCATAGTCCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009688.2-1989s21c1
Sequence:CCGGACAGCACTGTTTCCGTCTAAACTCGAGTTTAGACGGAAACAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009688.2-1573s21c1
Sequence:CCGGATCCGGGAGCAGCTATCTATCCTCGAGGATAGATAGCTGCTCCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009688.1-2233s1c1
Sequence:CCGGGCATTTGCATTCCATTAGCATCTCGAGATGCTAATGGAATGCAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009688.1-1539s1c1
Sequence:CCGGGCTTTAGGTGAAGGCGATAAACTCGAGTTTATCGCCTTCACCTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009688.1-876s1c1
Sequence:CCGGGCAATAGATAGATGGCAGTATCTCGAGATACTGCCATCTATCTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009688.1-1702s1c1
Sequence:CCGGCCCATCCACTTGAGGAATCTTCTCGAGAAGATTCCTCAAGTGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009688.1-2125s1c1
Sequence:CCGGCCGTCATTACGTTCAACCAAACTCGAGTTTGGTTGAACGTAATGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009688
VALIDATED
XIAP MISSION shRNA Lentiviral Transduction Particles
X-linked inhibitor of apoptosis
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009688.2-820s21c1
Sequence:CCGGAGATATTTCAGACACCATATACTCGAGTATATGGTGTCTGAAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009688.2-1821s21c1
Sequence:CCGGCCATGTGCTACACCGTCATTACTCGAGTAATGACGGTGTAGCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009688.2-896s21c1
Sequence:CCGGTGGCCGGACTATGCTCATTTACTCGAGTAAATGAGCATAGTCCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009688.2-1989s21c1
Sequence:CCGGACAGCACTGTTTCCGTCTAAACTCGAGTTTAGACGGAAACAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009688.2-1573s21c1
Sequence:CCGGATCCGGGAGCAGCTATCTATCCTCGAGGATAGATAGCTGCTCCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009688.1-2233s1c1
Sequence:CCGGGCATTTGCATTCCATTAGCATCTCGAGATGCTAATGGAATGCAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009688.1-1539s1c1
Sequence:CCGGGCTTTAGGTGAAGGCGATAAACTCGAGTTTATCGCCTTCACCTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009688.1-876s1c1
Sequence:CCGGGCAATAGATAGATGGCAGTATCTCGAGATACTGCCATCTATCTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009688.1-1702s1c1
Sequence:CCGGCCCATCCACTTGAGGAATCTTCTCGAGAAGATTCCTCAAGTGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009688.1-2125s1c1
Sequence:CCGGCCGTCATTACGTTCAACCAAACTCGAGTTTGGTTGAACGTAATGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001167
VALIDATED
XIAP MISSION shRNA Bacterial Glycerol Stock
X-linked inhibitor of apoptosis
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001167.2-691s21c1
Sequence:CCGGGACTCTACTACACAGGTATTGCTCGAGCAATACCTGTGTAGTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001167.2-1321s21c1
Sequence:CCGGAGATATCTGGGAGCAACTATACTCGAGTATAGTTGCTCCCAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001167.2-2149s21c1
Sequence:CCGGACACGTACTTGTGCGAATTATCTCGAGATAATTCGCACAAGTACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001167.2-904s21c1
Sequence:CCGGATCCATCCATGGCAGATTATGCTCGAGCATAATCTGCCATGGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001167.2-301s21c1
Sequence:CCGGGAGATACCGTGCGGTGCTTTACTCGAGTAAAGCACCGCACGGTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001167.x-309s1c1
Sequence:CCGGGTGCGGTGCTTTAGTTGTCATCTCGAGATGACAACTAAAGCACCGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001167.x-332s1c1
Sequence:CCGGAGCTGTAGATAGATGGCAATACTCGAGTATTGCCATCTATCTACAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001167.x-4261s1c1
Sequence:CCGGGCACTCCAACTTCTAATCAAACTCGAGTTTGATTAGAAGTTGGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001167.x-459s1c1
Sequence:CCGGCAGAATGGTCAGTACAAAGTTCTCGAGAACTTTGTACTGACCATTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001167
VALIDATED
XIAP MISSION shRNA shRNA Plasmid DNA
X-linked inhibitor of apoptosis
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001167.2-691s21c1
Sequence:CCGGGACTCTACTACACAGGTATTGCTCGAGCAATACCTGTGTAGTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001167.2-1321s21c1
Sequence:CCGGAGATATCTGGGAGCAACTATACTCGAGTATAGTTGCTCCCAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001167.2-2149s21c1
Sequence:CCGGACACGTACTTGTGCGAATTATCTCGAGATAATTCGCACAAGTACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001167.2-904s21c1
Sequence:CCGGATCCATCCATGGCAGATTATGCTCGAGCATAATCTGCCATGGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001167.2-301s21c1
Sequence:CCGGGAGATACCGTGCGGTGCTTTACTCGAGTAAAGCACCGCACGGTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001167.x-309s1c1
Sequence:CCGGGTGCGGTGCTTTAGTTGTCATCTCGAGATGACAACTAAAGCACCGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001167.x-332s1c1
Sequence:CCGGAGCTGTAGATAGATGGCAATACTCGAGTATTGCCATCTATCTACAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001167.x-4261s1c1
Sequence:CCGGGCACTCCAACTTCTAATCAAACTCGAGTTTGATTAGAAGTTGGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001167.x-459s1c1
Sequence:CCGGCAGAATGGTCAGTACAAAGTTCTCGAGAACTTTGTACTGACCATTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001167
VALIDATED
XIAP MISSION shRNA Lentiviral Transduction Particles
X-linked inhibitor of apoptosis
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001167.2-691s21c1
Sequence:CCGGGACTCTACTACACAGGTATTGCTCGAGCAATACCTGTGTAGTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001167.2-1321s21c1
Sequence:CCGGAGATATCTGGGAGCAACTATACTCGAGTATAGTTGCTCCCAGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231579    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001167.2-2149s21c1
Sequence:CCGGACACGTACTTGTGCGAATTATCTCGAGATAATTCGCACAAGTACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001167.2-904s21c1
Sequence:CCGGATCCATCCATGGCAGATTATGCTCGAGCATAATCTGCCATGGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001167.2-301s21c1
Sequence:CCGGGAGATACCGTGCGGTGCTTTACTCGAGTAAAGCACCGCACGGTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001167.x-309s1c1
Sequence:CCGGGTGCGGTGCTTTAGTTGTCATCTCGAGATGACAACTAAAGCACCGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001167.x-332s1c1
Sequence:CCGGAGCTGTAGATAGATGGCAATACTCGAGTATTGCCATCTATCTACAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001167.x-4261s1c1
Sequence:CCGGGCACTCCAACTTCTAATCAAACTCGAGTTTGATTAGAAGTTGGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001167.x-459s1c1
Sequence:CCGGCAGAATGGTCAGTACAAAGTTCTCGAGAACTTTGTACTGACCATTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks