EMAIL THIS PAGE TO A FRIEND

XIRP1

xin actin-binding repeat containing 1

Synonyms: CMYA1 Xin
Gene ID:
Mouse(22437) xin actin-binding repeat containing 1
Rat(316071) xin actin-binding repeat containing 1
Zebrafish(497637) xin actin-binding repeat containing 1
domestic cat(101084568) xin actin-binding repeat containing 1
Horse(100055451) xin actin-binding repeat containing 1
dog(485597) xin actin-binding repeat containing 1
chicken(374266) xin actin-binding repeat containing 1
cow(509670) xin actin-binding repeat containing 1
sheep(101112767) xin actin-binding repeat containing 1
Domestic Rabbit(100348317) xin actin-binding repeat containing 1
naked mole-rat(101706778) xin actin-binding repeat containing 1
domestic guinea pig(100735341) xin actin-binding repeat containing 1
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0746 AQUA Peptide WIFENW[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194293 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081339 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081339 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081339 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194293 Rosetta Predictions human pricing
XM_001077697 Rosetta Predictions rat pricing
XM_236702 Rosetta Predictions rat pricing
NM_001081339 Rosetta Predictions mouse pricing
XM_622090 Rosetta Predictions mouse pricing
XM_895131 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081419 predicted 2016
2 SASI_Hs01_00081420 predicted 1725
3 SASI_Hs01_00081422 predicted 4315
4 SASI_Hs01_00081423 predicted 5271
5 SASI_Hs01_00081424 predicted 5086
6 SASI_Hs01_00081425 predicted 4929
7 SASI_Hs01_00081426 predicted 4335
8 SASI_Hs01_00081427 predicted 5081
9 SASI_Hs01_00081428 predicted 4363
10 SASI_Hs02_00371424 predicted 2691
11 SASI_Hs01_00081421 predicted 4935
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077697 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358154 predicted 3123
2 SASI_Rn02_00358155 predicted 5415
3 SASI_Rn02_00358156 predicted 629
4 SASI_Rn02_00358157 predicted 3265
5 SASI_Rn02_00358158 predicted 1232
6 SASI_Rn02_00358159 predicted 298
7 SASI_Rn02_00358160 predicted 4320
8 SASI_Rn02_00358161 predicted 4560
9 SASI_Rn02_00358162 predicted 3732
10 SASI_Rn02_00358163 predicted 2259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236702 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390349 predicted 1021
2 SASI_Rn02_00390350 predicted 1055
3 SASI_Rn02_00390351 predicted 268
4 SASI_Rn02_00390352 predicted 459
5 SASI_Rn02_00390353 predicted 626
6 SASI_Rn02_00390354 predicted 296
7 SASI_Rn02_00390355 predicted 1060
8 SASI_Rn02_00390356 predicted 826
9 SASI_Rn02_00390357 predicted 270
10 SASI_Rn02_00390358 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081339 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297441 predicted 2033
2 SASI_Mm02_00297442 predicted 273
3 SASI_Mm02_00297443 predicted 4261
4 SASI_Mm02_00297444 predicted 3450
5 SASI_Mm02_00297445 predicted 4710
6 SASI_Mm02_00297446 predicted 303
7 SASI_Mm02_00297447 predicted 1260
8 SASI_Mm02_00297448 predicted 1979
9 SASI_Mm02_00297449 predicted 1448
10 SASI_Mm02_00297450 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_622090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260919 predicted 430
2 SASI_Mm01_00260920 predicted 2210
3 SASI_Mm01_00260921 predicted 447
4 SASI_Mm01_00260922 predicted 4044
5 SASI_Mm01_00260923 predicted 326
6 SASI_Mm01_00260924 predicted 2208
7 SASI_Mm01_00260925 predicted 473
8 SASI_Mm01_00260926 predicted 516
9 SASI_Mm01_00260927 predicted 2157
10 SASI_Mm01_00260928 predicted 2301
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265571 predicted 262
2 SASI_Mm01_00265572 predicted 303
3 SASI_Mm01_00265573 predicted 369
4 SASI_Mm01_00265574 predicted 278
5 SASI_Mm01_00265575 predicted 254
6 SASI_Mm01_00265576 predicted 301
7 SASI_Mm01_00265577 predicted 342
8 SASI_Mm01_00265578 predicted 232
9 SASI_Mm01_00265579 predicted 402
10 SASI_Mm01_00265580 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194293
XIRP1 MISSION shRNA Bacterial Glycerol Stock
xin actin-binding repeat containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194293.2-5087s1c1
Sequence:CCGGGAGTCAAGTCAAGATCAGAAACTCGAGTTTCTGATCTTGACTTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194293.2-2394s1c1
Sequence:CCGGGTCCACAAGTTCACTTGGCTTCTCGAGAAGCCAAGTGAACTTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194293.2-4824s1c1
Sequence:CCGGGAAGTTGCTCAACTGAAGGAACTCGAGTTCCTTCAGTTGAGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194293.2-3425s1c1
Sequence:CCGGGCACCAGCAAGTTCTGAACAACTCGAGTTGTTCAGAACTTGCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194293.2-2018s1c1
Sequence:CCGGGACTTGCCCAATGAGTGAGTTCTCGAGAACTCACTCATTGGGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194293.2-689s1c1
Sequence:CCGGCCGCTGGCTATTTGAGACAAACTCGAGTTTGTCTCAAATAGCCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194293.2-4970s1c1
Sequence:CCGGCCACAAGATCAGTGTCACAGTCTCGAGACTGTGACACTGATCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194293.2-496s21c1
Sequence:CCGGAGTGCATGCGCTGGATCTTTGCTCGAGCAAAGATCCAGCGCATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194293.2-5518s21c1
Sequence:CCCGGAACCGTGACTGAACAGTATGCTCGAGCATACTGTTCAGTCACGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194293.2-1135s21c1
Sequence:CCGGGTGCAACTCGCTGGATCTTTGCTCGAGCAAAGATCCAGCGAGTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194293
XIRP1 MISSION shRNA shRNA Plasmid DNA
xin actin-binding repeat containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194293.2-5087s1c1
Sequence:CCGGGAGTCAAGTCAAGATCAGAAACTCGAGTTTCTGATCTTGACTTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194293.2-2394s1c1
Sequence:CCGGGTCCACAAGTTCACTTGGCTTCTCGAGAAGCCAAGTGAACTTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194293.2-4824s1c1
Sequence:CCGGGAAGTTGCTCAACTGAAGGAACTCGAGTTCCTTCAGTTGAGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194293.2-3425s1c1
Sequence:CCGGGCACCAGCAAGTTCTGAACAACTCGAGTTGTTCAGAACTTGCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194293.2-2018s1c1
Sequence:CCGGGACTTGCCCAATGAGTGAGTTCTCGAGAACTCACTCATTGGGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194293.2-689s1c1
Sequence:CCGGCCGCTGGCTATTTGAGACAAACTCGAGTTTGTCTCAAATAGCCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194293.2-4970s1c1
Sequence:CCGGCCACAAGATCAGTGTCACAGTCTCGAGACTGTGACACTGATCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194293.2-496s21c1
Sequence:CCGGAGTGCATGCGCTGGATCTTTGCTCGAGCAAAGATCCAGCGCATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194293.2-5518s21c1
Sequence:CCCGGAACCGTGACTGAACAGTATGCTCGAGCATACTGTTCAGTCACGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194293.2-1135s21c1
Sequence:CCGGGTGCAACTCGCTGGATCTTTGCTCGAGCAAAGATCCAGCGAGTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194293
XIRP1 MISSION shRNA Lentiviral Transduction Particles
xin actin-binding repeat containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194293.2-5087s1c1
Sequence:CCGGGAGTCAAGTCAAGATCAGAAACTCGAGTTTCTGATCTTGACTTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194293.2-2394s1c1
Sequence:CCGGGTCCACAAGTTCACTTGGCTTCTCGAGAAGCCAAGTGAACTTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194293.2-4824s1c1
Sequence:CCGGGAAGTTGCTCAACTGAAGGAACTCGAGTTCCTTCAGTTGAGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194293.2-3425s1c1
Sequence:CCGGGCACCAGCAAGTTCTGAACAACTCGAGTTGTTCAGAACTTGCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194293.2-2018s1c1
Sequence:CCGGGACTTGCCCAATGAGTGAGTTCTCGAGAACTCACTCATTGGGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194293.2-689s1c1
Sequence:CCGGCCGCTGGCTATTTGAGACAAACTCGAGTTTGTCTCAAATAGCCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194293.2-4970s1c1
Sequence:CCGGCCACAAGATCAGTGTCACAGTCTCGAGACTGTGACACTGATCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194293.2-496s21c1
Sequence:CCGGAGTGCATGCGCTGGATCTTTGCTCGAGCAAAGATCCAGCGCATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194293.2-5518s21c1
Sequence:CCCGGAACCGTGACTGAACAGTATGCTCGAGCATACTGTTCAGTCACGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194293.2-1135s21c1
Sequence:CCGGGTGCAACTCGCTGGATCTTTGCTCGAGCAAAGATCCAGCGAGTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081339
XIRP1 MISSION shRNA Bacterial Glycerol Stock
xin actin-binding repeat containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081339.1-4939s21c1
Sequence:CCGGGGATCCTCCTCTCCAACTTTCCTCGAGGAAAGTTGGAGAGGAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081339.1-914s21c1
Sequence:CCGGGTGCAACTCGTTGGATCTTTGCTCGAGCAAAGATCCAACGAGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081339.1-768s21c1
Sequence:CCGGCTGTCGGGAGGAGATTCAAAGCTCGAGCTTTGAATCTCCTCCCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081339.1-1136s21c1
Sequence:CCGGGCTCTACACTCTGGCTATTTGCTCGAGCAAATAGCCAGAGTGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081339.1-275s21c1
Sequence:CCGGAGTGTATGCGCTGGATCTTTGCTCGAGCAAAGATCCAGCGCATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081339
XIRP1 MISSION shRNA shRNA Plasmid DNA
xin actin-binding repeat containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081339.1-4939s21c1
Sequence:CCGGGGATCCTCCTCTCCAACTTTCCTCGAGGAAAGTTGGAGAGGAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081339.1-914s21c1
Sequence:CCGGGTGCAACTCGTTGGATCTTTGCTCGAGCAAAGATCCAACGAGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081339.1-768s21c1
Sequence:CCGGCTGTCGGGAGGAGATTCAAAGCTCGAGCTTTGAATCTCCTCCCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081339.1-1136s21c1
Sequence:CCGGGCTCTACACTCTGGCTATTTGCTCGAGCAAATAGCCAGAGTGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081339.1-275s21c1
Sequence:CCGGAGTGTATGCGCTGGATCTTTGCTCGAGCAAAGATCCAGCGCATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081339
XIRP1 MISSION shRNA Lentiviral Transduction Particles
xin actin-binding repeat containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081339.1-4939s21c1
Sequence:CCGGGGATCCTCCTCTCCAACTTTCCTCGAGGAAAGTTGGAGAGGAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081339.1-914s21c1
Sequence:CCGGGTGCAACTCGTTGGATCTTTGCTCGAGCAAAGATCCAACGAGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081339.1-768s21c1
Sequence:CCGGCTGTCGGGAGGAGATTCAAAGCTCGAGCTTTGAATCTCCTCCCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081339.1-1136s21c1
Sequence:CCGGGCTCTACACTCTGGCTATTTGCTCGAGCAAATAGCCAGAGTGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081339.1-275s21c1
Sequence:CCGGAGTGTATGCGCTGGATCTTTGCTCGAGCAAAGATCCAGCGCATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks