EMAIL THIS PAGE TO A FRIEND

XIRP2

xin actin-binding repeat containing 2

Synonyms: CMYA3
Gene ID:
Mouse(241431) xin actin-binding repeat containing 2
Rat(311098) xin actin-binding repeat containing 2
domestic guinea pig(100715274) xin actin-binding repeat containing 2
naked mole-rat(101708131) xin actin-binding repeat containing 2
Domestic Rabbit(100357577) xin actin-binding repeat containing 2
cow(506090) xin actin-binding repeat containing 2
sheep(101108995) xin actin-binding repeat containing 2
dog(478778) xin actin-binding repeat containing 2
Horse(100052180) xin actin-binding repeat containing 2
domestic cat(101086587) xin actin-binding repeat containing 2
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0746 AQUA Peptide WIFENW[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024618 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024618 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024618 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152381 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152381 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152381 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082641 MISSION® esiRNA esiRNA human XIRP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079810 Rosetta Predictions human pricing
NM_152381 Rosetta Predictions human pricing
NM_201989 Rosetta Predictions rat pricing
NM_001024618 Rosetta Predictions mouse pricing
NM_001083919 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313770 predicted 2455
2 SASI_Hs02_00313771 predicted 2614
3 SASI_Hs02_00313772 predicted 1461
4 SASI_Hs02_00313773 predicted 819
5 SASI_Hs02_00313774 predicted 531
6 SASI_Hs02_00313775 predicted 1399
7 SASI_Hs02_00313776 predicted 2348
8 SASI_Hs02_00313777 predicted 2872
9 SASI_Hs02_00313778 predicted 353
10 SASI_Hs02_00313779 predicted 2275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366035 predicted 368
2 SASI_Hs02_00366036 predicted 822
3 SASI_Hs02_00366037 predicted 775
4 SASI_Hs02_00366038 predicted 531
5 SASI_Hs02_00366039 predicted 494
6 SASI_Hs02_00366040 predicted 444
7 SASI_Hs02_00366041 predicted 350
8 SASI_Hs02_00366042 predicted 427
9 SASI_Hs02_00366043 predicted 488
10 SASI_Hs02_00366044 predicted 245
11 SASI_Hs01_00243877 predicted 3929
12 SASI_Hs01_00243878 predicted 4993
13 SASI_Hs01_00243879 predicted 1177
14 SASI_Hs01_00243880 predicted 1759
15 SASI_Hs01_00243881 predicted 9379
16 SASI_Hs01_00243882 predicted 2176
17 SASI_Hs01_00243883 predicted 779
18 SASI_Hs01_00243884 predicted 6249
19 SASI_Hs01_00243885 predicted 1580
20 SASI_Hs01_00243886 predicted 7967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201989 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087426 predicted 9540
2 SASI_Rn02_00270343 predicted 1273
3 SASI_Rn01_00087427 predicted 9896
4 SASI_Rn01_00087428 predicted 5749
5 SASI_Rn01_00087429 predicted 5525
6 SASI_Rn02_00270344 predicted 3827
7 SASI_Rn01_00087431 predicted 6825
8 SASI_Rn01_00087432 predicted 1081
9 SASI_Rn01_00087433 predicted 3611
10 SASI_Rn01_00087434 predicted 2620
11 SASI_Rn01_00087430 predicted 8222
12 SASI_Rn01_00087435 predicted 9891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130531 predicted 1294
2 SASI_Mm01_00130532 predicted 5371
3 SASI_Mm01_00130533 predicted 4120
4 SASI_Mm01_00130535 predicted 7591
5 SASI_Mm01_00130536 predicted 2426
6 SASI_Mm01_00130537 predicted 5790
7 SASI_Mm01_00130538 predicted 6774
8 SASI_Mm01_00130539 predicted 3625
9 SASI_Mm01_00130540 predicted 8630
10 SASI_Mm02_00287634 predicted 9179
11 SASI_Mm01_00130534 predicted 9868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299996 predicted 1294
2 SASI_Mm02_00299997 predicted 4125
3 SASI_Mm02_00299998 predicted 9862
4 SASI_Mm02_00299999 predicted 7594
5 SASI_Mm02_00300000 predicted 2420
6 SASI_Mm02_00300001 predicted 5786
7 SASI_Mm02_00300002 predicted 6775
8 SASI_Mm02_00300003 predicted 3633
9 SASI_Mm02_00300004 predicted 8631
10 SASI_Mm02_00300005 predicted 9175
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024618
XIRP2 MISSION shRNA Bacterial Glycerol Stock
xin actin-binding repeat containing 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024618.2-10136s21c1
Sequence:CCGGATCACTTCACGGACGAATATACTCGAGTATATTCGTCCGTGAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024618.2-11733s21c1
Sequence:CCGGCTTGTATGCACTCCGTAATTCCTCGAGGAATTACGGAGTGCATACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024618.2-10135s1c1
Sequence:CCGGCATCACTTCACGGACGAATATCTCGAGATATTCGTCCGTGAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024618.2-9523s1c1
Sequence:CCGGCTTATGCAAATGGCGAAATAACTCGAGTTATTTCGCCATTTGCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024618.2-3780s21c1
Sequence:CCGGGTGCCCACTGTTGACTATATTCTCGAGAATATAGTCAACAGTGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024618.2-4150s21c1
Sequence:CCGGCAACACCTATTCACGAATTTACTCGAGTAAATTCGTGAATAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024618.1-11746s1c1
Sequence:CCGGCCGTAATTCTTTGTCACAATTCTCGAGAATTGTGACAAAGAATTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024618.1-1387s1c1
Sequence:CCGGGCTGGAAGTGATGTGAAATATCTCGAGATATTTCACATCACTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024618
XIRP2 MISSION shRNA shRNA Plasmid DNA
xin actin-binding repeat containing 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024618.2-10136s21c1
Sequence:CCGGATCACTTCACGGACGAATATACTCGAGTATATTCGTCCGTGAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024618.2-11733s21c1
Sequence:CCGGCTTGTATGCACTCCGTAATTCCTCGAGGAATTACGGAGTGCATACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024618.2-10135s1c1
Sequence:CCGGCATCACTTCACGGACGAATATCTCGAGATATTCGTCCGTGAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024618.2-9523s1c1
Sequence:CCGGCTTATGCAAATGGCGAAATAACTCGAGTTATTTCGCCATTTGCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024618.2-3780s21c1
Sequence:CCGGGTGCCCACTGTTGACTATATTCTCGAGAATATAGTCAACAGTGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024618.2-4150s21c1
Sequence:CCGGCAACACCTATTCACGAATTTACTCGAGTAAATTCGTGAATAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024618.1-11746s1c1
Sequence:CCGGCCGTAATTCTTTGTCACAATTCTCGAGAATTGTGACAAAGAATTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024618.1-1387s1c1
Sequence:CCGGGCTGGAAGTGATGTGAAATATCTCGAGATATTTCACATCACTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024618
XIRP2 MISSION shRNA Lentiviral Transduction Particles
xin actin-binding repeat containing 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024618.2-10136s21c1
Sequence:CCGGATCACTTCACGGACGAATATACTCGAGTATATTCGTCCGTGAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024618.2-11733s21c1
Sequence:CCGGCTTGTATGCACTCCGTAATTCCTCGAGGAATTACGGAGTGCATACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024618.2-10135s1c1
Sequence:CCGGCATCACTTCACGGACGAATATCTCGAGATATTCGTCCGTGAAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024618.2-9523s1c1
Sequence:CCGGCTTATGCAAATGGCGAAATAACTCGAGTTATTTCGCCATTTGCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024618.2-3780s21c1
Sequence:CCGGGTGCCCACTGTTGACTATATTCTCGAGAATATAGTCAACAGTGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024618.2-4150s21c1
Sequence:CCGGCAACACCTATTCACGAATTTACTCGAGTAAATTCGTGAATAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182922    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024618.1-11746s1c1
Sequence:CCGGCCGTAATTCTTTGTCACAATTCTCGAGAATTGTGACAAAGAATTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024618.1-1387s1c1
Sequence:CCGGGCTGGAAGTGATGTGAAATATCTCGAGATATTTCACATCACTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152381
XIRP2 MISSION shRNA Bacterial Glycerol Stock
xin actin-binding repeat containing 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-7822s1c1
Sequence:CCGGGCAAGCACTGAATGTAGTCATCTCGAGATGACTACATTCAGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152381.3-2738s1c1
Sequence:CCGGCCCAACCTCTTGATTCAATTACTCGAGTAATTGAATCAAGAGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152381.3-719s1c1
Sequence:CCGGCCAAGCAGATTAAGACTGAAACTCGAGTTTCAGTCTTAATCTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152381.3-7734s1c1
Sequence:CCGGCCACAGCTATGAAAGTCATAACTCGAGTTATGACTTTCATAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-1887s1c1
Sequence:CCGGGCCGTTGGACACAATTAACAACTCGAGTTGTTAATTGTGTCCAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-7495s1c1
Sequence:CCGGGCAGCTTCAGAAGACAAAGATCTCGAGATCTTTGTCTTCTGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-1278s1c1
Sequence:CCGGGCAGTCCATTAGATGGATCTTCTCGAGAAGATCCATCTAATGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-3739s1c1
Sequence:CCGGCCACTGGATCAGATTTCTGAACTCGAGTTCAGAAATCTGATCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-1539s1c1
Sequence:CCGGGCCATTGGACTCAATGAATAACTCGAGTTATTCATTGAGTCCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-3488s1c1
Sequence:CCGGGCTACAGAATGCTCTTTGAAACTCGAGTTTCAAAGAGCATTCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152381.3-6903s1c1
Sequence:CCGGCCTGTCAGATATGGAATGTAACTCGAGTTACATTCCATATCTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-9791s1c1
Sequence:CCGGCCAGGTCTCTAAGTGAACATTCTCGAGAATGTTCACTTAGAGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152381.3-348s1c1
Sequence:CCGGCGAAATTACTTCTTCCCGTAACTCGAGTTACGGGAAGAAGTAATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152381
XIRP2 MISSION shRNA shRNA Plasmid DNA
xin actin-binding repeat containing 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-7822s1c1
Sequence:CCGGGCAAGCACTGAATGTAGTCATCTCGAGATGACTACATTCAGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152381.3-2738s1c1
Sequence:CCGGCCCAACCTCTTGATTCAATTACTCGAGTAATTGAATCAAGAGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152381.3-719s1c1
Sequence:CCGGCCAAGCAGATTAAGACTGAAACTCGAGTTTCAGTCTTAATCTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152381.3-7734s1c1
Sequence:CCGGCCACAGCTATGAAAGTCATAACTCGAGTTATGACTTTCATAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-1887s1c1
Sequence:CCGGGCCGTTGGACACAATTAACAACTCGAGTTGTTAATTGTGTCCAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-7495s1c1
Sequence:CCGGGCAGCTTCAGAAGACAAAGATCTCGAGATCTTTGTCTTCTGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-1278s1c1
Sequence:CCGGGCAGTCCATTAGATGGATCTTCTCGAGAAGATCCATCTAATGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-3739s1c1
Sequence:CCGGCCACTGGATCAGATTTCTGAACTCGAGTTCAGAAATCTGATCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-1539s1c1
Sequence:CCGGGCCATTGGACTCAATGAATAACTCGAGTTATTCATTGAGTCCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-3488s1c1
Sequence:CCGGGCTACAGAATGCTCTTTGAAACTCGAGTTTCAAAGAGCATTCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152381.3-6903s1c1
Sequence:CCGGCCTGTCAGATATGGAATGTAACTCGAGTTACATTCCATATCTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-9791s1c1
Sequence:CCGGCCAGGTCTCTAAGTGAACATTCTCGAGAATGTTCACTTAGAGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152381.3-348s1c1
Sequence:CCGGCGAAATTACTTCTTCCCGTAACTCGAGTTACGGGAAGAAGTAATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152381
XIRP2 MISSION shRNA Lentiviral Transduction Particles
xin actin-binding repeat containing 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-7822s1c1
Sequence:CCGGGCAAGCACTGAATGTAGTCATCTCGAGATGACTACATTCAGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152381.3-2738s1c1
Sequence:CCGGCCCAACCTCTTGATTCAATTACTCGAGTAATTGAATCAAGAGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152381.3-719s1c1
Sequence:CCGGCCAAGCAGATTAAGACTGAAACTCGAGTTTCAGTCTTAATCTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152381.3-7734s1c1
Sequence:CCGGCCACAGCTATGAAAGTCATAACTCGAGTTATGACTTTCATAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-1887s1c1
Sequence:CCGGGCCGTTGGACACAATTAACAACTCGAGTTGTTAATTGTGTCCAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-7495s1c1
Sequence:CCGGGCAGCTTCAGAAGACAAAGATCTCGAGATCTTTGTCTTCTGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-1278s1c1
Sequence:CCGGGCAGTCCATTAGATGGATCTTCTCGAGAAGATCCATCTAATGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-3739s1c1
Sequence:CCGGCCACTGGATCAGATTTCTGAACTCGAGTTCAGAAATCTGATCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-1539s1c1
Sequence:CCGGGCCATTGGACTCAATGAATAACTCGAGTTATTCATTGAGTCCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-3488s1c1
Sequence:CCGGGCTACAGAATGCTCTTTGAAACTCGAGTTTCAAAGAGCATTCTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152381.3-6903s1c1
Sequence:CCGGCCTGTCAGATATGGAATGTAACTCGAGTTACATTCCATATCTGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152381.3-9791s1c1
Sequence:CCGGCCAGGTCTCTAAGTGAACATTCTCGAGAATGTTCACTTAGAGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152381.3-348s1c1
Sequence:CCGGCGAAATTACTTCTTCCCGTAACTCGAGTTACGGGAAGAAGTAATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks