EMAIL THIS PAGE TO A FRIEND

XK

X-linked Kx blood group (McLeod syndrome)

Synonyms: KX MCLDS X1k XKR1
UniProtKB ID: P51811, Q4TTN6, Q8IUK6, Q9UC77
Gene ID:
Human(7504) Summary: This locus controls the synthesis of the Kell blood group 'precursor substance' (Kx). Mutations in this gene have been associated with McLeod syndrome, an X-linked, recessive disorder characterized by abnormalities in the neuromuscular and hematopoietic systems. The encoded protein has structural characteristics of prokaryotic and eukaryotic membrane transport proteins. [provided by RefSeq, Jul 2008]
Mouse(22439) Kell blood group precursor (McLeod phenotype) homolog
Rat(497078) X-linked Kx blood group (McLeod syndrome)
cow(539621) X-linked Kx blood group (McLeod syndrome)
sheep(101120554) X-linked Kx blood group (McLeod syndrome)
Domestic Rabbit(100340091) X-linked Kx blood group (McLeod syndrome)
naked mole-rat(101709849) X-linked Kx blood group (McLeod syndrome)
domestic guinea pig(100721057) X-linked Kx blood group (McLeod syndrome)
Zebrafish(497076) X-linked Kx blood group (McLeod syndrome)
chicken(427991) X-linked Kx blood group (McLeod syndrome)
dog(491824) X-linked Kx blood group (McLeod syndrome)
Horse(100055094) X-linked Kx blood group (McLeod syndrome)
domestic cat(101082982) X-linked Kx blood group (McLeod syndrome)
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102721 Anti-XK (ab1) antibody produced in rabbit affinity isolated antibody human, guinea pig, rabbit, canine, mouse, rat
western blot pricing
SAB2102722 Anti-XK (ab2) antibody produced in rabbit affinity isolated antibody human, horse, mouse, rabbit, rat, canine, guinea pig
western blot pricing
HPA019036 Anti-XK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021083 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021083 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021083 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021083 Rosetta Predictions human pricing
NM_001012227 Rosetta Predictions rat pricing
NM_023500 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121316 predicted 1499
2 SASI_Hs01_00121317 predicted 1007
3 SASI_Hs01_00121318 predicted 743
4 SASI_Hs01_00121319 predicted 1370
5 SASI_Hs01_00121320 predicted 922
6 SASI_Hs01_00121321 predicted 345
7 SASI_Hs01_00121322 predicted 659
8 SASI_Hs01_00121323 predicted 890
9 SASI_Hs01_00121324 predicted 582
10 SASI_Hs01_00121325 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200486 predicted 551
2 SASI_Rn02_00200487 predicted 385
3 SASI_Rn02_00200488 predicted 386
4 SASI_Rn02_00200489 predicted 1313
5 SASI_Rn01_00079649 predicted 1488
6 SASI_Rn02_00200490 predicted 712
7 SASI_Rn02_00200491 predicted 429
8 SASI_Rn02_00200492 predicted 713
9 SASI_Rn02_00200493 predicted 842
10 SASI_Rn01_00079650 predicted 1503
11 SASI_Rn01_00079648 predicted 1522
12 SASI_Rn01_00079651 predicted 1517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327146 predicted 1461
2 SASI_Mm01_00117411 predicted 488
3 SASI_Mm01_00117412 predicted 869
4 SASI_Mm01_00117414 predicted 647
5 SASI_Mm01_00117415 predicted 1476
6 SASI_Mm01_00117413 predicted 1603
7 SASI_Mm01_00117416 predicted 1149
8 SASI_Mm01_00117417 predicted 692
9 SASI_Mm01_00117418 predicted 1426
10 SASI_Mm01_00117419 predicted 1290
11 SASI_Mm01_00117420 predicted 765
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023500
XK MISSION shRNA Bacterial Glycerol Stock
X-linked Kx blood group (McLeod syndrome)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023500.1-1397s1c1
Sequence:CCGGCAGAGCAAGATGTAATGCCTACTCGAGTAGGCATTACATCTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023500.1-1086s1c1
Sequence:CCGGCCGCCTGCTCATTTACTACATCTCGAGATGTAGTAAATGAGCAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023500.1-1088s1c1
Sequence:CCGGGCCTGCTCATTTACTACATGACTCGAGTCATGTAGTAAATGAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023500.1-690s1c1
Sequence:CCGGCGCCTTACGTTGCAACATCTTCTCGAGAAGATGTTGCAACGTAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023500.2-1606s21c1
Sequence:CCGGGGGACTAAGGCACGAAGTTAGCTCGAGCTAACTTCGTGCCTTAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000450274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023500.2-875s21c1
Sequence:CCGGCATCGTCCTGGTCCTCTTTACCTCGAGGTAAAGAGGACCAGGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023500
XK MISSION shRNA shRNA Plasmid DNA
X-linked Kx blood group (McLeod syndrome)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023500.1-1397s1c1
Sequence:CCGGCAGAGCAAGATGTAATGCCTACTCGAGTAGGCATTACATCTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023500.1-1086s1c1
Sequence:CCGGCCGCCTGCTCATTTACTACATCTCGAGATGTAGTAAATGAGCAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023500.1-1088s1c1
Sequence:CCGGGCCTGCTCATTTACTACATGACTCGAGTCATGTAGTAAATGAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023500.1-690s1c1
Sequence:CCGGCGCCTTACGTTGCAACATCTTCTCGAGAAGATGTTGCAACGTAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023500.2-1606s21c1
Sequence:CCGGGGGACTAAGGCACGAAGTTAGCTCGAGCTAACTTCGTGCCTTAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000450274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023500.2-875s21c1
Sequence:CCGGCATCGTCCTGGTCCTCTTTACCTCGAGGTAAAGAGGACCAGGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023500
XK MISSION shRNA Lentiviral Transduction Particles
X-linked Kx blood group (McLeod syndrome)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023500.1-1397s1c1
Sequence:CCGGCAGAGCAAGATGTAATGCCTACTCGAGTAGGCATTACATCTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023500.1-1086s1c1
Sequence:CCGGCCGCCTGCTCATTTACTACATCTCGAGATGTAGTAAATGAGCAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023500.1-1088s1c1
Sequence:CCGGGCCTGCTCATTTACTACATGACTCGAGTCATGTAGTAAATGAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023500.1-690s1c1
Sequence:CCGGCGCCTTACGTTGCAACATCTTCTCGAGAAGATGTTGCAACGTAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023500.2-1606s21c1
Sequence:CCGGGGGACTAAGGCACGAAGTTAGCTCGAGCTAACTTCGTGCCTTAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000450274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023500.2-875s21c1
Sequence:CCGGCATCGTCCTGGTCCTCTTTACCTCGAGGTAAAGAGGACCAGGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021083
VALIDATED
XK MISSION shRNA Bacterial Glycerol Stock
X-linked Kx blood group (McLeod syndrome)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021083.2-912s1c1
Sequence:CCGGCCATTGTACTATGCTTTCTAACTCGAGTTAGAAAGCATAGTACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_021083.2-1180s1c1
Sequence:CCGGGCTTGTATTCTATCAGTTCTTCTCGAGAAGAACTGATAGAATACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021083.2-462s1c1
Sequence:CCGGGCAAACTAATCACCCACCGATCTCGAGATCGGTGGGTGATTAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021083.2-360s1c1
Sequence:CCGGCAGGCAACAATGAAGAGCCTTCTCGAGAAGGCTCTTCATTGTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021083.2-1166s1c1
Sequence:CCGGGCCATTCTCTTCATGCTTGTACTCGAGTACAAGCATGAAGAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021083.2-1430s21c1
Sequence:CCGGTCTCAGAGCACAGGCATATTACTCGAGTAATATGCCTGTGCTCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021083.2-1037s21c1
Sequence:CCGGGTGTATTACATGATAAGATTCCTCGAGGAATCTTATCATGTAATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021083.2-783s21c1
Sequence:CCGGAGACCTGGGTGGTGGTTATAACTCGAGTTATAACCACCACCCAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021083.2-1343s21c1
Sequence:CCGGGAGACACCTTCTAGCAGTAAACTCGAGTTTACTGCTAGAAGGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021083.2-1709s21c1
Sequence:CCGGTTGTACTGGTTAGATTCATTACTCGAGTAATGAATCTAACCAGTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021083
VALIDATED
XK MISSION shRNA shRNA Plasmid DNA
X-linked Kx blood group (McLeod syndrome)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021083.2-912s1c1
Sequence:CCGGCCATTGTACTATGCTTTCTAACTCGAGTTAGAAAGCATAGTACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_021083.2-1180s1c1
Sequence:CCGGGCTTGTATTCTATCAGTTCTTCTCGAGAAGAACTGATAGAATACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021083.2-462s1c1
Sequence:CCGGGCAAACTAATCACCCACCGATCTCGAGATCGGTGGGTGATTAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021083.2-360s1c1
Sequence:CCGGCAGGCAACAATGAAGAGCCTTCTCGAGAAGGCTCTTCATTGTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021083.2-1166s1c1
Sequence:CCGGGCCATTCTCTTCATGCTTGTACTCGAGTACAAGCATGAAGAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021083.2-1430s21c1
Sequence:CCGGTCTCAGAGCACAGGCATATTACTCGAGTAATATGCCTGTGCTCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021083.2-1037s21c1
Sequence:CCGGGTGTATTACATGATAAGATTCCTCGAGGAATCTTATCATGTAATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021083.2-783s21c1
Sequence:CCGGAGACCTGGGTGGTGGTTATAACTCGAGTTATAACCACCACCCAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021083.2-1343s21c1
Sequence:CCGGGAGACACCTTCTAGCAGTAAACTCGAGTTTACTGCTAGAAGGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021083.2-1709s21c1
Sequence:CCGGTTGTACTGGTTAGATTCATTACTCGAGTAATGAATCTAACCAGTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021083
VALIDATED
XK MISSION shRNA Lentiviral Transduction Particles
X-linked Kx blood group (McLeod syndrome)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021083.2-912s1c1
Sequence:CCGGCCATTGTACTATGCTTTCTAACTCGAGTTAGAAAGCATAGTACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_021083.2-1180s1c1
Sequence:CCGGGCTTGTATTCTATCAGTTCTTCTCGAGAAGAACTGATAGAATACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021083.2-462s1c1
Sequence:CCGGGCAAACTAATCACCCACCGATCTCGAGATCGGTGGGTGATTAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021083.2-360s1c1
Sequence:CCGGCAGGCAACAATGAAGAGCCTTCTCGAGAAGGCTCTTCATTGTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021083.2-1166s1c1
Sequence:CCGGGCCATTCTCTTCATGCTTGTACTCGAGTACAAGCATGAAGAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021083.2-1430s21c1
Sequence:CCGGTCTCAGAGCACAGGCATATTACTCGAGTAATATGCCTGTGCTCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021083.2-1037s21c1
Sequence:CCGGGTGTATTACATGATAAGATTCCTCGAGGAATCTTATCATGTAATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021083.2-783s21c1
Sequence:CCGGAGACCTGGGTGGTGGTTATAACTCGAGTTATAACCACCACCCAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021083.2-1343s21c1
Sequence:CCGGGAGACACCTTCTAGCAGTAAACTCGAGTTTACTGCTAGAAGGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021083.2-1709s21c1
Sequence:CCGGTTGTACTGGTTAGATTCATTACTCGAGTAATGAATCTAACCAGTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks