EMAIL THIS PAGE TO A FRIEND

XKR3

XK, Kell blood group complex subunit-related family, member 3

Synonyms: XRG3 XTES
Species: Human XKR3(150165)
UniProtKB ID: Q5GH77, B2RPN1, Q52PG8, Q8N7E1
Gene ID:
Human(150165) Summary: XKRX (MIM 300684) and XKR3 are homologs of the Kell blood group precursor XK (MIM 314850), which is a putative membrane transporter and a component of the XK/Kell complex of the Kell blood group system (Calenda et al., 2006 [PubMed 16431037]
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175878 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175878 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175878 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066391 MISSION® esiRNA esiRNA human XKR3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175878 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201007 predicted 1425
2 SASI_Hs01_00201008 predicted 1266
3 SASI_Hs01_00201009 predicted 761
4 SASI_Hs01_00201010 predicted 431
5 SASI_Hs01_00201011 predicted 293
6 SASI_Hs02_00369154 predicted 1239
7 SASI_Hs01_00201012 predicted 286
8 SASI_Hs02_00369155 predicted 541
9 SASI_Hs01_00201013 predicted 989
10 SASI_Hs01_00201014 predicted 638
11 SASI_Hs01_00201015 predicted 675
12 SASI_Hs01_00201016 predicted 446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175878
XKR3 MISSION shRNA Bacterial Glycerol Stock
XK, Kell blood group complex subunit-related family, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175878.3-547s21c1
Sequence:CCGGCATTCTCAATCCGGGATAATTCTCGAGAATTATCCCGGATTGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175878.3-1516s21c1
Sequence:CCGGATGCTGAATGTGACTTGTTAACTCGAGTTAACAAGTCACATTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175878.3-1427s21c1
Sequence:CCGGCTGCAATAGGGTTGGATATTTCTCGAGAAATATCCAACCCTATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175878.3-1347s21c1
Sequence:CCGGCCAGAAGCACCGTACTATTATCTCGAGATAATAGTACGGTGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175878.3-1231s21c1
Sequence:CCGGTTGCCGTGCAGCTCATCATAACTCGAGTTATGATGAGCTGCACGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175878.2-295s1c1
Sequence:CCGGGATGTCATTTACCATCAGCTTCTCGAGAAGCTGATGGTAAATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175878.2-616s1c1
Sequence:CCGGCGGTTCTGTTCCACAATTAATCTCGAGATTAATTGTGGAACAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175878.2-760s1c1
Sequence:CCGGCAGCAATGATGATACTACCATCTCGAGATGGTAGTATCATCATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175878
XKR3 MISSION shRNA shRNA Plasmid DNA
XK, Kell blood group complex subunit-related family, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175878.3-547s21c1
Sequence:CCGGCATTCTCAATCCGGGATAATTCTCGAGAATTATCCCGGATTGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175878.3-1516s21c1
Sequence:CCGGATGCTGAATGTGACTTGTTAACTCGAGTTAACAAGTCACATTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175878.3-1427s21c1
Sequence:CCGGCTGCAATAGGGTTGGATATTTCTCGAGAAATATCCAACCCTATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175878.3-1347s21c1
Sequence:CCGGCCAGAAGCACCGTACTATTATCTCGAGATAATAGTACGGTGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175878.3-1231s21c1
Sequence:CCGGTTGCCGTGCAGCTCATCATAACTCGAGTTATGATGAGCTGCACGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175878.2-295s1c1
Sequence:CCGGGATGTCATTTACCATCAGCTTCTCGAGAAGCTGATGGTAAATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175878.2-616s1c1
Sequence:CCGGCGGTTCTGTTCCACAATTAATCTCGAGATTAATTGTGGAACAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175878.2-760s1c1
Sequence:CCGGCAGCAATGATGATACTACCATCTCGAGATGGTAGTATCATCATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175878
XKR3 MISSION shRNA Lentiviral Transduction Particles
XK, Kell blood group complex subunit-related family, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175878.3-547s21c1
Sequence:CCGGCATTCTCAATCCGGGATAATTCTCGAGAATTATCCCGGATTGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175878.3-1516s21c1
Sequence:CCGGATGCTGAATGTGACTTGTTAACTCGAGTTAACAAGTCACATTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175878.3-1427s21c1
Sequence:CCGGCTGCAATAGGGTTGGATATTTCTCGAGAAATATCCAACCCTATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175878.3-1347s21c1
Sequence:CCGGCCAGAAGCACCGTACTATTATCTCGAGATAATAGTACGGTGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175878.3-1231s21c1
Sequence:CCGGTTGCCGTGCAGCTCATCATAACTCGAGTTATGATGAGCTGCACGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175878.2-295s1c1
Sequence:CCGGGATGTCATTTACCATCAGCTTCTCGAGAAGCTGATGGTAAATGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175878.2-616s1c1
Sequence:CCGGCGGTTCTGTTCCACAATTAATCTCGAGATTAATTGTGGAACAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175878.2-760s1c1
Sequence:CCGGCAGCAATGATGATACTACCATCTCGAGATGGTAGTATCATCATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks