EMAIL THIS PAGE TO A FRIEND

XKR4

XK, Kell blood group complex subunit-related family, member 4

Synonyms: XRG4
UniProtKB ID: Q5GH76, Q96PZ8
Gene ID:
Mouse(497097) X Kell blood group precursor related family member 4
Rat(297801) XK, Kell blood group complex subunit-related family, member 4
Horse(100068138) XK, Kell blood group complex subunit-related family, member 4
domestic cat(101081439) XK, Kell blood group complex subunit-related family, member 4
dog(609128) XK, Kell blood group complex subunit-related family, member 4
domestic guinea pig(100714099) XK, Kell blood group complex subunit-related family, member 4
naked mole-rat(101707276) XK, Kell blood group complex subunit-related family, member 4
Domestic Rabbit(100358767) XK, Kell blood group complex subunit-related family, member 4
cow(517598) XK, Kell blood group complex subunit-related family, member 4
sheep(101108498) XK, Kell blood group complex subunit-related family, member 4
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052898 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001011874 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001011874 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001011874 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU227471 MISSION® esiRNA esiRNA targeting human XKR4 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052898 Rosetta Predictions human pricing
NM_001011971 Rosetta Predictions rat pricing
NM_001011874 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361632 predicted 1186
2 SASI_Hs01_00196562 predicted 1552
3 SASI_Hs01_00196563 predicted 946
4 SASI_Hs02_00361633 predicted 672
5 SASI_Hs01_00196564 predicted 805
6 SASI_Hs02_00361634 predicted 1229
7 SASI_Hs01_00196565 predicted 995
8 SASI_Hs01_00196566 predicted 849
9 SASI_Hs01_00196567 predicted 1962
10 SASI_Hs01_00196568 predicted 1936
11 SASI_Hs01_00196561 predicted 1970
12 SASI_Hs01_00196569 predicted 2053
13 SASI_Hs01_00196570 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105573 predicted 1911
2 SASI_Rn01_00105574 predicted 2187
3 SASI_Rn01_00105575 predicted 1703
4 SASI_Rn01_00105577 predicted 422
5 SASI_Rn01_00105578 predicted 931
6 SASI_Rn02_00199993 predicted 1913
7 SASI_Rn01_00105579 predicted 1779
8 SASI_Rn01_00105580 predicted 2082
9 SASI_Rn01_00105581 predicted 1136
10 SASI_Rn01_00105582 predicted 1428
11 SASI_Rn01_00105576 predicted 1411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072077 predicted 1653
2 SASI_Mm01_00072078 predicted 1400
3 SASI_Mm01_00072079 predicted 1108
4 SASI_Mm01_00072080 predicted 1899
5 SASI_Mm01_00072081 predicted 1798
6 SASI_Mm01_00072082 predicted 1081
7 SASI_Mm01_00072083 predicted 1350
8 SASI_Mm01_00072084 predicted 2170
9 SASI_Mm01_00072085 predicted 1039
10 SASI_Mm01_00072086 predicted 1711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052898
XKR4 MISSION shRNA Bacterial Glycerol Stock
XK, Kell blood group complex subunit-related family, member 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052898.1-1929s1c1
Sequence:CCGGCAGTACAAAGATGATGCCCTTCTCGAGAAGGGCATCATCTTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052898.1-1226s1c1
Sequence:CCGGGCTGTACTTTGGGATCTTCATCTCGAGATGAAGATCCCAAAGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052898.1-1000s1c1
Sequence:CCGGGCATTATCGTACAGACTCATACTCGAGTATGAGTCTGTACGATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052898.1-1550s1c1
Sequence:CCGGGCTGATGTATTATGCCTTCTTCTCGAGAAGAAGGCATAATACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052898.1-3417s1c1
Sequence:CCGGCCGGTCAAACTTTGATAGTATCTCGAGATACTATCAAAGTTTGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052898.1-2570s1c1
Sequence:CCGGCGGACAGCAAACCCAAATGTTCTCGAGAACATTTGGGTTTGCTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052898.1-1731s1c1
Sequence:CCGGGATGGGTGTGTACCTGTCTTTCTCGAGAAAGACAGGTACACACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052898.1-945s1c1
Sequence:CCGGCTGCATTTGCTAGCCACCTTTCTCGAGAAAGGTGGCTAGCAAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052898.1-2101s21c1
Sequence:CCCGCCGTCATCACCATTATCATTTCTCGAGAAATGATAATGGTGATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052898.1-812s21c1
Sequence:CCGGCATCTTGCAGCTCGGGCAAATCTCGAGATTTGCCCGAGCTGCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052898
XKR4 MISSION shRNA shRNA Plasmid DNA
XK, Kell blood group complex subunit-related family, member 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052898.1-1929s1c1
Sequence:CCGGCAGTACAAAGATGATGCCCTTCTCGAGAAGGGCATCATCTTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052898.1-1226s1c1
Sequence:CCGGGCTGTACTTTGGGATCTTCATCTCGAGATGAAGATCCCAAAGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052898.1-1000s1c1
Sequence:CCGGGCATTATCGTACAGACTCATACTCGAGTATGAGTCTGTACGATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052898.1-1550s1c1
Sequence:CCGGGCTGATGTATTATGCCTTCTTCTCGAGAAGAAGGCATAATACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052898.1-3417s1c1
Sequence:CCGGCCGGTCAAACTTTGATAGTATCTCGAGATACTATCAAAGTTTGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052898.1-2570s1c1
Sequence:CCGGCGGACAGCAAACCCAAATGTTCTCGAGAACATTTGGGTTTGCTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052898.1-1731s1c1
Sequence:CCGGGATGGGTGTGTACCTGTCTTTCTCGAGAAAGACAGGTACACACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052898.1-945s1c1
Sequence:CCGGCTGCATTTGCTAGCCACCTTTCTCGAGAAAGGTGGCTAGCAAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052898.1-2101s21c1
Sequence:CCCGCCGTCATCACCATTATCATTTCTCGAGAAATGATAATGGTGATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052898.1-812s21c1
Sequence:CCGGCATCTTGCAGCTCGGGCAAATCTCGAGATTTGCCCGAGCTGCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052898
XKR4 MISSION shRNA Lentiviral Transduction Particles
XK, Kell blood group complex subunit-related family, member 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052898.1-1929s1c1
Sequence:CCGGCAGTACAAAGATGATGCCCTTCTCGAGAAGGGCATCATCTTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052898.1-1226s1c1
Sequence:CCGGGCTGTACTTTGGGATCTTCATCTCGAGATGAAGATCCCAAAGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052898.1-1000s1c1
Sequence:CCGGGCATTATCGTACAGACTCATACTCGAGTATGAGTCTGTACGATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052898.1-1550s1c1
Sequence:CCGGGCTGATGTATTATGCCTTCTTCTCGAGAAGAAGGCATAATACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052898.1-3417s1c1
Sequence:CCGGCCGGTCAAACTTTGATAGTATCTCGAGATACTATCAAAGTTTGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052898.1-2570s1c1
Sequence:CCGGCGGACAGCAAACCCAAATGTTCTCGAGAACATTTGGGTTTGCTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052898.1-1731s1c1
Sequence:CCGGGATGGGTGTGTACCTGTCTTTCTCGAGAAAGACAGGTACACACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052898.1-945s1c1
Sequence:CCGGCTGCATTTGCTAGCCACCTTTCTCGAGAAAGGTGGCTAGCAAATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052898.1-2101s21c1
Sequence:CCCGCCGTCATCACCATTATCATTTCTCGAGAAATGATAATGGTGATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052898.1-812s21c1
Sequence:CCGGCATCTTGCAGCTCGGGCAAATCTCGAGATTTGCCCGAGCTGCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011874
XKR4 MISSION shRNA Bacterial Glycerol Stock
XK, Kell blood group complex subunit-related family, member 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011874.1-954s1c1
Sequence:CCGGGCACACAATATACTTAGGTATCTCGAGATACCTAAGTATATTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183012    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011874.1-2368s1c1
Sequence:CCGGCCTCTAATCATTAGGGTATTTCTCGAGAAATACCCTAATGATTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011874.1-1659s1c1
Sequence:CCGGGCTGATGTACTATGCCTTCTTCTCGAGAAGAAGGCATAGTACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011874.1-1906s1c1
Sequence:CCGGCGGATTGAAGAATCAGTCATTCTCGAGAATGACTGATTCTTCAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011874
XKR4 MISSION shRNA shRNA Plasmid DNA
XK, Kell blood group complex subunit-related family, member 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011874.1-954s1c1
Sequence:CCGGGCACACAATATACTTAGGTATCTCGAGATACCTAAGTATATTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183012    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011874.1-2368s1c1
Sequence:CCGGCCTCTAATCATTAGGGTATTTCTCGAGAAATACCCTAATGATTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011874.1-1659s1c1
Sequence:CCGGGCTGATGTACTATGCCTTCTTCTCGAGAAGAAGGCATAGTACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011874.1-1906s1c1
Sequence:CCGGCGGATTGAAGAATCAGTCATTCTCGAGAATGACTGATTCTTCAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011874
XKR4 MISSION shRNA Lentiviral Transduction Particles
XK, Kell blood group complex subunit-related family, member 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011874.1-954s1c1
Sequence:CCGGGCACACAATATACTTAGGTATCTCGAGATACCTAAGTATATTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183012    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011874.1-2368s1c1
Sequence:CCGGCCTCTAATCATTAGGGTATTTCTCGAGAAATACCCTAATGATTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011874.1-1659s1c1
Sequence:CCGGGCTGATGTACTATGCCTTCTTCTCGAGAAGAAGGCATAGTACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011874.1-1906s1c1
Sequence:CCGGCGGATTGAAGAATCAGTCATTCTCGAGAATGACTGATTCTTCAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks