EMAIL THIS PAGE TO A FRIEND

XKR5

XK, Kell blood group complex subunit-related family, member 5

Synonyms: HARL2754 UNQ2754 XRG5A XRG5BM
UniProtKB ID: Q6UX68, Q5GH74
Gene ID:
Mouse(319581) X Kell blood group precursor-related family, member 5
Rat(497083) XK, Kell blood group complex subunit-related family, member 5
cow(529365) XK, Kell blood group complex subunit-related family, member 5
sheep(101104122) XK, Kell blood group complex subunit-related family, member 5
naked mole-rat(101713587) XK, Kell blood group complex subunit-related family, member 5
domestic guinea pig(100720671) XK, Kell blood group complex subunit-related family, member 5
chicken(422039) XK, Kell blood group complex subunit-related family, member 5
dog(482942) XK, Kell blood group complex subunit-related family, member 5
Horse(100063897) XK, Kell blood group complex subunit-related family, member 5
domestic cat(101083075) XK, Kell blood group complex subunit-related family, member 5
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176951 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176951 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176951 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207411 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087411 MISSION® esiRNA esiRNA targeting mouse Xkr5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207411 Rosetta Predictions human pricing
NM_001012228 Rosetta Predictions rat pricing
NM_001113350 Rosetta Predictions mouse pricing
NM_176951 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374037 predicted 1282
2 SASI_Hs02_00374038 predicted 495
3 SASI_Hs01_00194784 predicted 800
4 SASI_Hs01_00194785 predicted 1423
5 SASI_Hs02_00374039 predicted 421
6 SASI_Hs01_00194786 predicted 811
7 SASI_Hs02_00374040 predicted 205
8 SASI_Hs02_00374041 predicted 1356
9 SASI_Hs02_00374042 predicted 1460
10 SASI_Hs02_00374043 predicted 1464
11 SASI_Hs01_00194783 predicted 1427
12 SASI_Hs01_00194787 predicted 1137
13 SASI_Hs01_00194788 predicted 1557
14 SASI_Hs01_00194789 predicted 1160
15 SASI_Hs01_00194790 predicted 1595
16 SASI_Hs01_00194791 predicted 1256
17 SASI_Hs01_00194792 predicted 1600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071478 predicted 631
2 SASI_Rn01_00071479 predicted 466
3 SASI_Rn01_00071480 predicted 766
4 SASI_Rn02_00200494 predicted 454
5 SASI_Rn01_00071481 predicted 313
6 SASI_Rn01_00071482 predicted 672
7 SASI_Rn01_00071483 predicted 945
8 SASI_Rn01_00071484 predicted 996
9 SASI_Rn01_00071485 predicted 780
10 SASI_Rn01_00071486 predicted 329
11 SASI_Rn01_00071487 predicted 1498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307423 predicted 934
2 SASI_Mm02_00307424 predicted 1144
3 SASI_Mm02_00307425 predicted 1816
4 SASI_Mm02_00307426 predicted 641
5 SASI_Mm02_00307427 predicted 444
6 SASI_Mm02_00307428 predicted 770
7 SASI_Mm02_00307429 predicted 972
8 SASI_Mm02_00307430 predicted 1880
9 SASI_Mm02_00307431 predicted 832
10 SASI_Mm02_00307432 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133661 predicted 1302
2 SASI_Mm01_00133662 predicted 1477
3 SASI_Mm01_00133663 predicted 1219
4 SASI_Mm01_00133664 predicted 2143
5 SASI_Mm01_00133665 predicted 2157
6 SASI_Mm01_00133666 predicted 2214
7 SASI_Mm01_00133667 predicted 1174
8 SASI_Mm01_00133668 predicted 1609
9 SASI_Mm01_00133669 predicted 1393
10 SASI_Mm01_00133670 predicted 964
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176951
XKR5 MISSION shRNA Bacterial Glycerol Stock
XK, Kell blood group complex subunit-related family, member 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176951.4-1301s21c1
Sequence:CCGGGTGTGCATCGCTGGTTATTTACTCGAGTAAATAACCAGCGATGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176951.4-2901s1c1
Sequence:CCGGGCTTAATCAGCTGCACTATTACTCGAGTAATAGTGCAGCTGATTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176951.4-1488s1c1
Sequence:CCGGGAGCTAACAAGTCTAGATAAGCTCGAGCTTATCTAGACTTGTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176951.4-2828s21c1
Sequence:CCGGTCCCTTGAGGCAACGTATATACTCGAGTATATACGTTGCCTCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176951.4-971s21c1
Sequence:CCGGGGTTCTGTTCTGCCGAGTTTACTCGAGTAAACTCGGCAGAACAGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176951.4-2149s21c1
Sequence:CCGGCTGTTACCGTGGCCAATATTACTCGAGTAATATTGGCCACGGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176951.4-1487s21c1
Sequence:CCGGTGAGCTAACAAGTCTAGATAACTCGAGTTATCTAGACTTGTTAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176951.2-1183s1c1
Sequence:CCGGGCTGGAGAACTCCATACTCTTCTCGAGAAGAGTATGGAGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176951.2-2143s1c1
Sequence:CCGGCGTGGCCAATATTAGTCCCATCTCGAGATGGGACTAATATTGGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176951
XKR5 MISSION shRNA shRNA Plasmid DNA
XK, Kell blood group complex subunit-related family, member 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176951.4-1301s21c1
Sequence:CCGGGTGTGCATCGCTGGTTATTTACTCGAGTAAATAACCAGCGATGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176951.4-2901s1c1
Sequence:CCGGGCTTAATCAGCTGCACTATTACTCGAGTAATAGTGCAGCTGATTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176951.4-1488s1c1
Sequence:CCGGGAGCTAACAAGTCTAGATAAGCTCGAGCTTATCTAGACTTGTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176951.4-2828s21c1
Sequence:CCGGTCCCTTGAGGCAACGTATATACTCGAGTATATACGTTGCCTCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176951.4-971s21c1
Sequence:CCGGGGTTCTGTTCTGCCGAGTTTACTCGAGTAAACTCGGCAGAACAGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176951.4-2149s21c1
Sequence:CCGGCTGTTACCGTGGCCAATATTACTCGAGTAATATTGGCCACGGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176951.4-1487s21c1
Sequence:CCGGTGAGCTAACAAGTCTAGATAACTCGAGTTATCTAGACTTGTTAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176951.2-1183s1c1
Sequence:CCGGGCTGGAGAACTCCATACTCTTCTCGAGAAGAGTATGGAGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176951.2-2143s1c1
Sequence:CCGGCGTGGCCAATATTAGTCCCATCTCGAGATGGGACTAATATTGGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176951
XKR5 MISSION shRNA Lentiviral Transduction Particles
XK, Kell blood group complex subunit-related family, member 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176951.4-1301s21c1
Sequence:CCGGGTGTGCATCGCTGGTTATTTACTCGAGTAAATAACCAGCGATGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176951.4-2901s1c1
Sequence:CCGGGCTTAATCAGCTGCACTATTACTCGAGTAATAGTGCAGCTGATTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176951.4-1488s1c1
Sequence:CCGGGAGCTAACAAGTCTAGATAAGCTCGAGCTTATCTAGACTTGTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176951.4-2828s21c1
Sequence:CCGGTCCCTTGAGGCAACGTATATACTCGAGTATATACGTTGCCTCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176951.4-971s21c1
Sequence:CCGGGGTTCTGTTCTGCCGAGTTTACTCGAGTAAACTCGGCAGAACAGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176951.4-2149s21c1
Sequence:CCGGCTGTTACCGTGGCCAATATTACTCGAGTAATATTGGCCACGGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176951.4-1487s21c1
Sequence:CCGGTGAGCTAACAAGTCTAGATAACTCGAGTTATCTAGACTTGTTAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176951.2-1183s1c1
Sequence:CCGGGCTGGAGAACTCCATACTCTTCTCGAGAAGAGTATGGAGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176951.2-2143s1c1
Sequence:CCGGCGTGGCCAATATTAGTCCCATCTCGAGATGGGACTAATATTGGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207411
XKR5 MISSION shRNA Bacterial Glycerol Stock
XK, Kell blood group complex subunit-related family, member 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207411.1-1414s1c1
Sequence:CCGGCTTAGAGAACAGCTCTGCGTTCTCGAGAACGCAGAGCTGTTCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207411.1-2053s1c1
Sequence:CCGGGATGAAGCAAGAGCCGAGTTTCTCGAGAAACTCGGCTCTTGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207411.1-1928s1c1
Sequence:CCGGCTAAGTCACCATGCAGCTGTTCTCGAGAACAGCTGCATGGTGACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207411.1-1208s1c1
Sequence:CCGGGAGGACTCTTTCCTCAGTCATCTCGAGATGACTGAGGAAAGAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207411.1-95s1c1
Sequence:CCGGGCTTACTACTTCACCACAGGACTCGAGTCCTGTGGTGAAGTAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207411.1-671s1c1
Sequence:CCGGCTGGTGATGACATTCTGGCTTCTCGAGAAGCCAGAATGTCATCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207411.1-392s1c1
Sequence:CCGGCACCTGCTGCTTCAGACATATCTCGAGATATGTCTGAAGCAGCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207411.1-1296s1c1
Sequence:CCGGGAGATAACAGTCCTGCCTATTCTCGAGAATAGGCAGGACTGTTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207411.1-422s1c1
Sequence:CCGGGCCTCAGACTTCACAGATATTCTCGAGAATATCTGTGAAGTCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207411.1-942s1c1
Sequence:CCGGGCAGTGTCTCACTGGTAATTTCTCGAGAAATTACCAGTGAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207411.1-2009s1c1
Sequence:CCGGCCTAAGTCTGAGTCTATCCAACTCGAGTTGGATAGACTCAGACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207411
XKR5 MISSION shRNA shRNA Plasmid DNA
XK, Kell blood group complex subunit-related family, member 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207411.1-1414s1c1
Sequence:CCGGCTTAGAGAACAGCTCTGCGTTCTCGAGAACGCAGAGCTGTTCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207411.1-2053s1c1
Sequence:CCGGGATGAAGCAAGAGCCGAGTTTCTCGAGAAACTCGGCTCTTGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207411.1-1928s1c1
Sequence:CCGGCTAAGTCACCATGCAGCTGTTCTCGAGAACAGCTGCATGGTGACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207411.1-1208s1c1
Sequence:CCGGGAGGACTCTTTCCTCAGTCATCTCGAGATGACTGAGGAAAGAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207411.1-95s1c1
Sequence:CCGGGCTTACTACTTCACCACAGGACTCGAGTCCTGTGGTGAAGTAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207411.1-671s1c1
Sequence:CCGGCTGGTGATGACATTCTGGCTTCTCGAGAAGCCAGAATGTCATCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207411.1-392s1c1
Sequence:CCGGCACCTGCTGCTTCAGACATATCTCGAGATATGTCTGAAGCAGCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207411.1-1296s1c1
Sequence:CCGGGAGATAACAGTCCTGCCTATTCTCGAGAATAGGCAGGACTGTTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207411.1-422s1c1
Sequence:CCGGGCCTCAGACTTCACAGATATTCTCGAGAATATCTGTGAAGTCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207411.1-942s1c1
Sequence:CCGGGCAGTGTCTCACTGGTAATTTCTCGAGAAATTACCAGTGAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207411.1-2009s1c1
Sequence:CCGGCCTAAGTCTGAGTCTATCCAACTCGAGTTGGATAGACTCAGACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207411
XKR5 MISSION shRNA Lentiviral Transduction Particles
XK, Kell blood group complex subunit-related family, member 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207411.1-1414s1c1
Sequence:CCGGCTTAGAGAACAGCTCTGCGTTCTCGAGAACGCAGAGCTGTTCTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207411.1-2053s1c1
Sequence:CCGGGATGAAGCAAGAGCCGAGTTTCTCGAGAAACTCGGCTCTTGCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207411.1-1928s1c1
Sequence:CCGGCTAAGTCACCATGCAGCTGTTCTCGAGAACAGCTGCATGGTGACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207411.1-1208s1c1
Sequence:CCGGGAGGACTCTTTCCTCAGTCATCTCGAGATGACTGAGGAAAGAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207411.1-95s1c1
Sequence:CCGGGCTTACTACTTCACCACAGGACTCGAGTCCTGTGGTGAAGTAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207411.1-671s1c1
Sequence:CCGGCTGGTGATGACATTCTGGCTTCTCGAGAAGCCAGAATGTCATCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207411.1-392s1c1
Sequence:CCGGCACCTGCTGCTTCAGACATATCTCGAGATATGTCTGAAGCAGCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207411.1-1296s1c1
Sequence:CCGGGAGATAACAGTCCTGCCTATTCTCGAGAATAGGCAGGACTGTTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207411.1-422s1c1
Sequence:CCGGGCCTCAGACTTCACAGATATTCTCGAGAATATCTGTGAAGTCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207411.1-942s1c1
Sequence:CCGGGCAGTGTCTCACTGGTAATTTCTCGAGAAATTACCAGTGAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207411.1-2009s1c1
Sequence:CCGGCCTAAGTCTGAGTCTATCCAACTCGAGTTGGATAGACTCAGACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks