EMAIL THIS PAGE TO A FRIEND

XKR6

XK, Kell blood group complex subunit-related family, member 6

Synonyms: C8orf21 C8orf5 C8orf7 XRG6
UniProtKB ID: Q5GH73, Q8TBA0
Gene ID:
Mouse(219149) X Kell blood group precursor related family member 6 homolog
Rat(305960) XK, Kell blood group complex subunit-related family, member 6
Zebrafish(792104) XK, Kell blood group complex subunit-related family, member 6
chicken(422029) XK, Kell blood group complex subunit-related family, member 6
domestic cat(101085883) XK, Kell blood group complex subunit-related family, member 6
dog(486082) XK, Kell blood group complex subunit-related family, member 6
domestic guinea pig(100717333) XK, Kell blood group complex subunit-related family, member 6
naked mole-rat(101704677) XK, Kell blood group complex subunit-related family, member 6
cow(539914) XK, Kell blood group complex subunit-related family, member 6
195 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173683 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173393 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173393 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173393 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173683 Rosetta Predictions human pricing
NM_001012042 Rosetta Predictions rat pricing
XM_001065482 Rosetta Predictions rat pricing
XM_573804 Rosetta Predictions rat pricing
NM_173393 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031139 predicted 850
2 SASI_Hs01_00031140 predicted 840
3 SASI_Hs01_00031141 predicted 785
4 SASI_Hs01_00031142 predicted 1470
5 SASI_Hs02_00368628 predicted 1450
6 SASI_Hs01_00031144 predicted 1487
7 SASI_Hs01_00031145 predicted 1652
8 SASI_Hs02_00368629 predicted 782
9 SASI_Hs01_00031146 predicted 1679
10 SASI_Hs01_00031148 predicted 1258
11 SASI_Hs01_00031143 predicted 1463
12 SASI_Hs01_00031147 predicted 1814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043158 predicted 1678
2 SASI_Rn01_00043159 predicted 1672
3 SASI_Rn02_00200141 predicted 1445
4 SASI_Rn01_00043160 predicted 1332
5 SASI_Rn01_00043161 predicted 922
6 SASI_Rn01_00043162 predicted 1474
7 SASI_Rn01_00043163 predicted 1108
8 SASI_Rn01_00043164 predicted 1374
9 SASI_Rn01_00043165 predicted 1439
10 SASI_Rn01_00043166 predicted 1476
11 SASI_Rn01_00043157 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065482 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314310 predicted 375
2 SASI_Rn02_00314311 predicted 305
3 SASI_Rn02_00314312 predicted 1204
4 SASI_Rn02_00314313 predicted 978
5 SASI_Rn02_00314314 predicted 378
6 SASI_Rn02_00314315 predicted 867
7 SASI_Rn02_00314316 predicted 456
8 SASI_Rn02_00314317 predicted 1014
9 SASI_Rn02_00314318 predicted 648
10 SASI_Rn02_00314319 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00196903 predicted 618
2 SASI_Rn01_00196904 predicted 624
3 SASI_Rn01_00196905 predicted 619
4 SASI_Rn01_00196906 predicted 589
5 SASI_Rn01_00196907 predicted 539
6 SASI_Rn01_00196908 predicted 1532
7 SASI_Rn01_00196909 predicted 1373
8 SASI_Rn01_00196910 predicted 1031
9 SASI_Rn01_00196911 predicted 1612
10 SASI_Rn01_00196912 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188729 predicted 860
2 SASI_Mm01_00188730 predicted 1206
3 SASI_Mm01_00188731 predicted 1197
4 SASI_Mm01_00188732 predicted 448
5 SASI_Mm01_00188733 predicted 1006
6 SASI_Mm01_00188734 predicted 646
7 SASI_Mm01_00188735 predicted 999
8 SASI_Mm01_00188736 predicted 907
9 SASI_Mm01_00188737 predicted 897
10 SASI_Mm01_00188738 predicted 778
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173683
XKR6 MISSION shRNA Bacterial Glycerol Stock
XK, Kell blood group complex subunit-related family, member 6
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173683.2-791s1c1
Sequence:CCGGGATCGCAATGATGCTCTTATACTCGAGTATAAGAGCATCATTGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173683.2-2313s1c1
Sequence:CCGGGCTGTGAATGGTAGACATTTACTCGAGTAAATGTCTACCATTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-756s1c1
Sequence:CCGGGCACTGTGTTGTGTCTTTATTCTCGAGAATAAAGACACAACACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173683.2-2694s1c1
Sequence:CCGGGCAAAGTCTTGCCAGAGATATCTCGAGATATCTCTGGCAAGACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-1142s1c1
Sequence:CCGGGAGGCTGAGAAGGACTATTAACTCGAGTTAATAGTCCTTCTCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-581s1c1
Sequence:CCGGCTTCAACATGGTGGTAGGGATCTCGAGATCCCTACCACCATGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-803s1c1
Sequence:CCGGGCTCTTATACTATGGCGTGCTCTCGAGAGCACGCCATAGTATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-693s1c1
Sequence:CCGGGCCTTGACGTTCCTTTGGTATCTCGAGATACCAAAGGAACGTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173683.2-639s1c1
Sequence:CCGGCGGACTCGATATCGAATGTTTCTCGAGAAACATTCGATATCGAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173683.2-2155s1c1
Sequence:CCGGCGGTAAGGACAGGATATTCTACTCGAGTAGAATATCCTGTCCTTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173683.2-1220s1c1
Sequence:CCGGCCTCTATGAGTTGCTACAGTACTCGAGTACTGTAGCAACTCATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-1145s1c1
Sequence:CCGGGCTGAGAAGGACTATTAACATCTCGAGATGTTAATAGTCCTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-794s1c1
Sequence:CCGGCGCAATGATGCTCTTATACTACTCGAGTAGTATAAGAGCATCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173683
XKR6 MISSION shRNA shRNA Plasmid DNA
XK, Kell blood group complex subunit-related family, member 6
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173683.2-791s1c1
Sequence:CCGGGATCGCAATGATGCTCTTATACTCGAGTATAAGAGCATCATTGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173683.2-2313s1c1
Sequence:CCGGGCTGTGAATGGTAGACATTTACTCGAGTAAATGTCTACCATTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-756s1c1
Sequence:CCGGGCACTGTGTTGTGTCTTTATTCTCGAGAATAAAGACACAACACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173683.2-2694s1c1
Sequence:CCGGGCAAAGTCTTGCCAGAGATATCTCGAGATATCTCTGGCAAGACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-1142s1c1
Sequence:CCGGGAGGCTGAGAAGGACTATTAACTCGAGTTAATAGTCCTTCTCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-581s1c1
Sequence:CCGGCTTCAACATGGTGGTAGGGATCTCGAGATCCCTACCACCATGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-803s1c1
Sequence:CCGGGCTCTTATACTATGGCGTGCTCTCGAGAGCACGCCATAGTATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-693s1c1
Sequence:CCGGGCCTTGACGTTCCTTTGGTATCTCGAGATACCAAAGGAACGTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173683.2-639s1c1
Sequence:CCGGCGGACTCGATATCGAATGTTTCTCGAGAAACATTCGATATCGAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173683.2-2155s1c1
Sequence:CCGGCGGTAAGGACAGGATATTCTACTCGAGTAGAATATCCTGTCCTTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173683.2-1220s1c1
Sequence:CCGGCCTCTATGAGTTGCTACAGTACTCGAGTACTGTAGCAACTCATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-1145s1c1
Sequence:CCGGGCTGAGAAGGACTATTAACATCTCGAGATGTTAATAGTCCTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-794s1c1
Sequence:CCGGCGCAATGATGCTCTTATACTACTCGAGTAGTATAAGAGCATCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173683
XKR6 MISSION shRNA Lentiviral Transduction Particles
XK, Kell blood group complex subunit-related family, member 6
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173683.2-791s1c1
Sequence:CCGGGATCGCAATGATGCTCTTATACTCGAGTATAAGAGCATCATTGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173683.2-2313s1c1
Sequence:CCGGGCTGTGAATGGTAGACATTTACTCGAGTAAATGTCTACCATTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-756s1c1
Sequence:CCGGGCACTGTGTTGTGTCTTTATTCTCGAGAATAAAGACACAACACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173683.2-2694s1c1
Sequence:CCGGGCAAAGTCTTGCCAGAGATATCTCGAGATATCTCTGGCAAGACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-1142s1c1
Sequence:CCGGGAGGCTGAGAAGGACTATTAACTCGAGTTAATAGTCCTTCTCAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-581s1c1
Sequence:CCGGCTTCAACATGGTGGTAGGGATCTCGAGATCCCTACCACCATGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-803s1c1
Sequence:CCGGGCTCTTATACTATGGCGTGCTCTCGAGAGCACGCCATAGTATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-693s1c1
Sequence:CCGGGCCTTGACGTTCCTTTGGTATCTCGAGATACCAAAGGAACGTCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173683.2-639s1c1
Sequence:CCGGCGGACTCGATATCGAATGTTTCTCGAGAAACATTCGATATCGAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173683.2-2155s1c1
Sequence:CCGGCGGTAAGGACAGGATATTCTACTCGAGTAGAATATCCTGTCCTTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173683.2-1220s1c1
Sequence:CCGGCCTCTATGAGTTGCTACAGTACTCGAGTACTGTAGCAACTCATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-1145s1c1
Sequence:CCGGGCTGAGAAGGACTATTAACATCTCGAGATGTTAATAGTCCTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173683.2-794s1c1
Sequence:CCGGCGCAATGATGCTCTTATACTACTCGAGTAGTATAAGAGCATCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173393
XKR6 MISSION shRNA Bacterial Glycerol Stock
XK, Kell blood group complex subunit-related family, member 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173393.1-1020s1c1
Sequence:CCGGGCTCTTATACTATGGCGTGTTCTCGAGAACACGCCATAGTATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173393.1-468s1c1
Sequence:CCGGCTGCATAATGATCCAGAAGAACTCGAGTTCTTCTGGATCATTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180493    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173393.1-1528s1c1
Sequence:CCGGGCCTGCAAGAAATATAACCCTCTCGAGAGGGTTATATTTCTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173393.1-1359s21c1
Sequence:CCGGGAGGCTGCGGAGGACTATTAACTCGAGTTAATAGTCCTCCGCAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173393.1-1476s21c1
Sequence:CCGGCACCTTGACCCAGATTGAGAACTCGAGTTCTCAATCTGGGTCAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173393.1-1215s21c1
Sequence:CCGGTGATACTTGCCTGCCGGTATTCTCGAGAATACCGGCAGGCAAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173393.1-866s21c1
Sequence:CCGGACCGAATGTTCGCATACTATACTCGAGTATAGTATGCGAACATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173393.1-645s21c1
Sequence:CCGGCACCATCTCATCCCGAGTTATCTCGAGATAACTCGGGATGAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173393
XKR6 MISSION shRNA shRNA Plasmid DNA
XK, Kell blood group complex subunit-related family, member 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173393.1-1020s1c1
Sequence:CCGGGCTCTTATACTATGGCGTGTTCTCGAGAACACGCCATAGTATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173393.1-468s1c1
Sequence:CCGGCTGCATAATGATCCAGAAGAACTCGAGTTCTTCTGGATCATTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180493    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173393.1-1528s1c1
Sequence:CCGGGCCTGCAAGAAATATAACCCTCTCGAGAGGGTTATATTTCTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173393.1-1359s21c1
Sequence:CCGGGAGGCTGCGGAGGACTATTAACTCGAGTTAATAGTCCTCCGCAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173393.1-1476s21c1
Sequence:CCGGCACCTTGACCCAGATTGAGAACTCGAGTTCTCAATCTGGGTCAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173393.1-1215s21c1
Sequence:CCGGTGATACTTGCCTGCCGGTATTCTCGAGAATACCGGCAGGCAAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173393.1-866s21c1
Sequence:CCGGACCGAATGTTCGCATACTATACTCGAGTATAGTATGCGAACATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173393.1-645s21c1
Sequence:CCGGCACCATCTCATCCCGAGTTATCTCGAGATAACTCGGGATGAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173393
XKR6 MISSION shRNA Lentiviral Transduction Particles
XK, Kell blood group complex subunit-related family, member 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173393.1-1020s1c1
Sequence:CCGGGCTCTTATACTATGGCGTGTTCTCGAGAACACGCCATAGTATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173393.1-468s1c1
Sequence:CCGGCTGCATAATGATCCAGAAGAACTCGAGTTCTTCTGGATCATTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180493    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173393.1-1528s1c1
Sequence:CCGGGCCTGCAAGAAATATAACCCTCTCGAGAGGGTTATATTTCTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173393.1-1359s21c1
Sequence:CCGGGAGGCTGCGGAGGACTATTAACTCGAGTTAATAGTCCTCCGCAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173393.1-1476s21c1
Sequence:CCGGCACCTTGACCCAGATTGAGAACTCGAGTTCTCAATCTGGGTCAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173393.1-1215s21c1
Sequence:CCGGTGATACTTGCCTGCCGGTATTCTCGAGAATACCGGCAGGCAAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173393.1-866s21c1
Sequence:CCGGACCGAATGTTCGCATACTATACTCGAGTATAGTATGCGAACATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173393.1-645s21c1
Sequence:CCGGCACCATCTCATCCCGAGTTATCTCGAGATAACTCGGGATGAGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks