EMAIL THIS PAGE TO A FRIEND

XKR7

XK, Kell blood group complex subunit-related family, member 7

Synonyms: C20orf159 dJ310O13.4
UniProtKB ID: Q5GH72, Q9NUG5
Gene ID:
Mouse(228787) X Kell blood group precursor related family member 7 homolog
Rat(311549) XK, Kell blood group complex subunit-related family, member 7
cow(518090) XK, Kell blood group complex subunit-related family, member 7
sheep(101112666) XK, Kell blood group complex subunit-related family, member 7
naked mole-rat(101710026) XK, Kell blood group complex subunit-related family, member 7
domestic guinea pig(100734005) XK, Kell blood group complex subunit-related family, member 7
Zebrafish(497073) XK, Kell blood group complex subunit-related family, member 7
domestic cat(101101455) XK, Kell blood group complex subunit-related family, member 7
dog(485827) XK, Kell blood group complex subunit-related family, member 7
chicken(771861) XK, Kell blood group complex subunit-related family, member 7
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001011718 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001011718 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001011718 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001011732 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001011732 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001011732 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055491 MISSION® esiRNA esiRNA human TMEM194B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011718 Rosetta Predictions human pricing
NM_001012092 Rosetta Predictions rat pricing
XM_575265 Rosetta Predictions rat pricing
NM_001011732 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232737 predicted 1729
2 SASI_Hs01_00232738 predicted 1741
3 SASI_Hs01_00232739 predicted 1311
4 SASI_Hs01_00232740 predicted 1180
5 SASI_Hs01_00232741 predicted 1809
6 SASI_Hs01_00232742 predicted 1737
7 SASI_Hs01_00232743 predicted 1397
8 SASI_Hs01_00232744 predicted 1175
9 SASI_Hs01_00232745 predicted 892
10 SASI_Hs01_00232746 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073046 predicted 1436
2 SASI_Rn01_00073048 predicted 1422
3 SASI_Rn01_00073049 predicted 1732
4 SASI_Rn01_00073050 predicted 555
5 SASI_Rn01_00073051 predicted 1733
6 SASI_Rn01_00073052 predicted 1994
7 SASI_Rn02_00200224 predicted 1023
8 SASI_Rn02_00200225 predicted 2199
9 SASI_Rn01_00073053 predicted 1951
10 SASI_Rn01_00073054 predicted 1884
11 SASI_Rn01_00073047 predicted 1725
12 SASI_Rn01_00073055 predicted 1124
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575265 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00196689 predicted 1445
2 SASI_Rn01_00196690 predicted 1729
3 SASI_Rn01_00196691 predicted 1435
4 SASI_Rn01_00196692 predicted 1734
5 SASI_Rn01_00196693 predicted 1733
6 SASI_Rn01_00196694 predicted 1995
7 SASI_Rn01_00196695 predicted 1025
8 SASI_Rn01_00196696 predicted 2202
9 SASI_Rn01_00196697 predicted 1959
10 SASI_Rn01_00196698 predicted 1882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094392 predicted 1444
2 SASI_Mm01_00094393 predicted 1799
3 SASI_Mm01_00094394 predicted 1730
4 SASI_Mm01_00094395 predicted 749
5 SASI_Mm01_00094396 predicted 553
6 SASI_Mm01_00094397 predicted 1877
7 SASI_Mm01_00094398 predicted 2011
8 SASI_Mm01_00094399 predicted 2350
9 SASI_Mm01_00094400 predicted 1735
10 SASI_Mm01_00094401 predicted 1875
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011718
XKR7 MISSION shRNA Bacterial Glycerol Stock
XK, Kell blood group complex subunit-related family, member 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011718.1-423s1c1
Sequence:CCGGGCAGAATCAACACACCTACTTCTCGAGAAGTAGGTGTGTTGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011718.1-1245s1c1
Sequence:CCGGGATCATCTACAACATGGTCGTCTCGAGACGACCATGTTGTAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011718.1-1746s1c1
Sequence:CCGGGATTGACTTGCCTCGCAAGAACTCGAGTTCTTGCGAGGCAAGTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011718.1-2605s1c1
Sequence:CCGGCCAGAGCATAGCGAACAAGAACTCGAGTTCTTGTTCGCTATGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011718.1-1404s1c1
Sequence:CCGGCGACTTCTACTCGCTCATCATCTCGAGATGATGAGCGAGTAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011718.1-1263s1c1
Sequence:CCGGCGTGGGCATCATCTACATCTTCTCGAGAAGATGTAGATGATGCCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011718.1-420s1c1
Sequence:CCGGCCTGCAGAATCAACACACCTACTCGAGTAGGTGTGTTGATTCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011718.1-2616s1c1
Sequence:CCGGCGAACAAGAATGAACTCCTTACTCGAGTAAGGAGTTCATTCTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011718.1-1457s1c1
Sequence:CCGGGCATATTCTTCATGTGTGTCTCTCGAGAGACACACATGAAGAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145108    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011718.1-2697s1c1
Sequence:CCGGGAAATGTTTGAAGGAGCCATTCTCGAGAATGGCTCCTTCAAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011718
XKR7 MISSION shRNA shRNA Plasmid DNA
XK, Kell blood group complex subunit-related family, member 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011718.1-423s1c1
Sequence:CCGGGCAGAATCAACACACCTACTTCTCGAGAAGTAGGTGTGTTGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011718.1-1245s1c1
Sequence:CCGGGATCATCTACAACATGGTCGTCTCGAGACGACCATGTTGTAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011718.1-1746s1c1
Sequence:CCGGGATTGACTTGCCTCGCAAGAACTCGAGTTCTTGCGAGGCAAGTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011718.1-2605s1c1
Sequence:CCGGCCAGAGCATAGCGAACAAGAACTCGAGTTCTTGTTCGCTATGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011718.1-1404s1c1
Sequence:CCGGCGACTTCTACTCGCTCATCATCTCGAGATGATGAGCGAGTAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011718.1-1263s1c1
Sequence:CCGGCGTGGGCATCATCTACATCTTCTCGAGAAGATGTAGATGATGCCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011718.1-420s1c1
Sequence:CCGGCCTGCAGAATCAACACACCTACTCGAGTAGGTGTGTTGATTCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011718.1-2616s1c1
Sequence:CCGGCGAACAAGAATGAACTCCTTACTCGAGTAAGGAGTTCATTCTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011718.1-1457s1c1
Sequence:CCGGGCATATTCTTCATGTGTGTCTCTCGAGAGACACACATGAAGAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145108    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011718.1-2697s1c1
Sequence:CCGGGAAATGTTTGAAGGAGCCATTCTCGAGAATGGCTCCTTCAAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011718
XKR7 MISSION shRNA Lentiviral Transduction Particles
XK, Kell blood group complex subunit-related family, member 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011718.1-423s1c1
Sequence:CCGGGCAGAATCAACACACCTACTTCTCGAGAAGTAGGTGTGTTGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011718.1-1245s1c1
Sequence:CCGGGATCATCTACAACATGGTCGTCTCGAGACGACCATGTTGTAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011718.1-1746s1c1
Sequence:CCGGGATTGACTTGCCTCGCAAGAACTCGAGTTCTTGCGAGGCAAGTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011718.1-2605s1c1
Sequence:CCGGCCAGAGCATAGCGAACAAGAACTCGAGTTCTTGTTCGCTATGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011718.1-1404s1c1
Sequence:CCGGCGACTTCTACTCGCTCATCATCTCGAGATGATGAGCGAGTAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011718.1-1263s1c1
Sequence:CCGGCGTGGGCATCATCTACATCTTCTCGAGAAGATGTAGATGATGCCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011718.1-420s1c1
Sequence:CCGGCCTGCAGAATCAACACACCTACTCGAGTAGGTGTGTTGATTCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011718.1-2616s1c1
Sequence:CCGGCGAACAAGAATGAACTCCTTACTCGAGTAAGGAGTTCATTCTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011718.1-1457s1c1
Sequence:CCGGGCATATTCTTCATGTGTGTCTCTCGAGAGACACACATGAAGAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145108    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011718.1-2697s1c1
Sequence:CCGGGAAATGTTTGAAGGAGCCATTCTCGAGAATGGCTCCTTCAAACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011732
XKR7 MISSION shRNA Bacterial Glycerol Stock
XK, Kell blood group complex subunit-related family, member 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011732.1-1127s1c1
Sequence:CCGGAGTGTCTACAAGCTCTACTTTCTCGAGAAAGTAGAGCTTGTAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011732.1-805s1c1
Sequence:CCGGGCGCCACTTCTACTGGCAGATCTCGAGATCTGCCAGTAGAAGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011732.1-1883s1c1
Sequence:CCGGCTGGAGTATGAGACCACAGTACTCGAGTACTGTGGTCTCATACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011732.1-1726s1c1
Sequence:CCGGGCCTGTCATTCGGATTGACTTCTCGAGAAGTCAATCCGAATGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011732.1-1986s1c1
Sequence:CCGGCCAGGCTAAGTGGGAATAGATCTCGAGATCTATTCCCACTTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011732
XKR7 MISSION shRNA shRNA Plasmid DNA
XK, Kell blood group complex subunit-related family, member 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011732.1-1127s1c1
Sequence:CCGGAGTGTCTACAAGCTCTACTTTCTCGAGAAAGTAGAGCTTGTAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011732.1-805s1c1
Sequence:CCGGGCGCCACTTCTACTGGCAGATCTCGAGATCTGCCAGTAGAAGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011732.1-1883s1c1
Sequence:CCGGCTGGAGTATGAGACCACAGTACTCGAGTACTGTGGTCTCATACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011732.1-1726s1c1
Sequence:CCGGGCCTGTCATTCGGATTGACTTCTCGAGAAGTCAATCCGAATGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011732.1-1986s1c1
Sequence:CCGGCCAGGCTAAGTGGGAATAGATCTCGAGATCTATTCCCACTTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011732
XKR7 MISSION shRNA Lentiviral Transduction Particles
XK, Kell blood group complex subunit-related family, member 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011732.1-1127s1c1
Sequence:CCGGAGTGTCTACAAGCTCTACTTTCTCGAGAAAGTAGAGCTTGTAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011732.1-805s1c1
Sequence:CCGGGCGCCACTTCTACTGGCAGATCTCGAGATCTGCCAGTAGAAGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011732.1-1883s1c1
Sequence:CCGGCTGGAGTATGAGACCACAGTACTCGAGTACTGTGGTCTCATACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011732.1-1726s1c1
Sequence:CCGGGCCTGTCATTCGGATTGACTTCTCGAGAAGTCAATCCGAATGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011732.1-1986s1c1
Sequence:CCGGCCAGGCTAAGTGGGAATAGATCTCGAGATCTATTCCCACTTAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks