EMAIL THIS PAGE TO A FRIEND

XKR8

XK, Kell blood group complex subunit-related family, member 8

Synonyms: RP11-460I13.3 XRG8
UniProtKB ID: Q9H6D3
Gene ID:
Mouse(381560) X Kell blood group precursor related family member 8 homolog
Rat(313033) XK, Kell blood group complex subunit-related family, member 8
chicken(724081) XK, Kell blood group complex subunit-related family, member 8
dog(487337) XK, Kell blood group complex subunit-related family, member 8
domestic cat(101090881) XK, Kell blood group complex subunit-related family, member 8
domestic guinea pig(100734909) XK, Kell blood group complex subunit-related family, member 8
naked mole-rat(101711177) XK, Kell blood group complex subunit-related family, member 8
cow(514365) XK, Kell blood group complex subunit-related family, member 8
sheep(101111696) XK, Kell blood group complex subunit-related family, member 8
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018053 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018053 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018053 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201368 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201368 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201368 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109341 MISSION® esiRNA esiRNA human RNF216L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018053 Rosetta Predictions human pricing
NM_001012099 Rosetta Predictions rat pricing
XM_575926 Rosetta Predictions rat pricing
NM_201368 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237026 predicted 445
2 SASI_Hs01_00237027 predicted 926
3 SASI_Hs01_00237031 predicted 1193
4 SASI_Hs01_00237033 predicted 1191
5 SASI_Hs01_00237035 predicted 929
6 SASI_Hs01_00237028 predicted 1303
7 SASI_Hs01_00237029 predicted 809
8 SASI_Hs01_00237030 predicted 569
9 SASI_Hs01_00237032 predicted 1456
10 SASI_Hs01_00237034 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063765 predicted 1614
2 SASI_Rn01_00063766 predicted 1357
3 SASI_Rn01_00063767 predicted 1626
4 SASI_Rn02_00200233 predicted 2181
5 SASI_Rn01_00063769 predicted 2316
6 SASI_Rn01_00063770 predicted 1729
7 SASI_Rn01_00063771 predicted 2338
8 SASI_Rn01_00063772 predicted 2207
9 SASI_Rn01_00063773 predicted 1821
10 SASI_Rn02_00200234 predicted 2088
11 SASI_Rn01_00063768 predicted 1927
12 SASI_Rn01_00063774 predicted 2014
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575926 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169598 predicted 2129
2 SASI_Rn01_00169599 predicted 1875
3 SASI_Rn01_00169600 predicted 2142
4 SASI_Rn01_00169601 predicted 2447
5 SASI_Rn01_00169602 predicted 2827
6 SASI_Rn01_00169603 predicted 2247
7 SASI_Rn01_00169604 predicted 2855
8 SASI_Rn01_00169605 predicted 2720
9 SASI_Rn01_00169606 predicted 2338
10 SASI_Rn01_00169607 predicted 2520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201368 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351525 predicted 1682
2 SASI_Mm02_00351526 predicted 553
3 SASI_Mm02_00351527 predicted 1024
4 SASI_Mm02_00351528 predicted 1640
5 SASI_Mm02_00351529 predicted 1627
6 SASI_Mm02_00351530 predicted 1741
7 SASI_Mm02_00351531 predicted 610
8 SASI_Mm02_00351532 predicted 959
9 SASI_Mm02_00351533 predicted 661
10 SASI_Mm02_00351534 predicted 847
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018053
VALIDATED
XKR8 MISSION shRNA Bacterial Glycerol Stock
XK, Kell blood group complex subunit-related family, member 8
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018053.2-1708s1c1
Sequence:CCGGCCACACCATTCATTCAATTCACTCGAGTGAATTGAATGAATGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018053.2-1196s1c1
Sequence:CCGGCATGACCCATTTAGCACAGAACTCGAGTTCTGTGCTAAATGGGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018053.2-1199s1c1
Sequence:CCGGGACCCATTTAGCACAGAAGTTCTCGAGAACTTCTGTGCTAAATGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018053.2-884s1c1
Sequence:CCGGCTATTTCTCCTGGTTCAACGTCTCGAGACGTTGAACCAGGAGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018053.2-1845s1c1
Sequence:CCGGCGGGTTAGATCCCAAATGCTACTCGAGTAGCATTTGGGATCTAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018053.2-877s1c1
Sequence:CCGGCCATCCTCTATTTCTCCTGGTCTCGAGACCAGGAGAAATAGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018053.2-422s1c1
Sequence:CCGGCTCTGAGTTTGACTTGGCCTACTCGAGTAGGCCAAGTCAAACTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139576    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018053.2-1857s1c1
Sequence:CCGGCAAATGCTAGAAGCCAGGGATCTCGAGATCCCTGGCTTCTAGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018053.2-1750s1c1
Sequence:CCGGGCAGTTTATGTGCCAGGAACACTCGAGTGTTCCTGGCACATAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140878    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018053.2-1748s1c1
Sequence:CCGGGAGCAGTTTATGTGCCAGGAACTCGAGTTCCTGGCACATAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018053.2-1751s1c1
Sequence:CCGGCAGTTTATGTGCCAGGAACATCTCGAGATGTTCCTGGCACATAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018053.2-1763s1c1
Sequence:CCGGCAGGAACATCATTCTGTCCTTCTCGAGAAGGACAGAATGATGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018053
VALIDATED
XKR8 MISSION shRNA shRNA Plasmid DNA
XK, Kell blood group complex subunit-related family, member 8
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018053.2-1708s1c1
Sequence:CCGGCCACACCATTCATTCAATTCACTCGAGTGAATTGAATGAATGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018053.2-1196s1c1
Sequence:CCGGCATGACCCATTTAGCACAGAACTCGAGTTCTGTGCTAAATGGGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018053.2-1199s1c1
Sequence:CCGGGACCCATTTAGCACAGAAGTTCTCGAGAACTTCTGTGCTAAATGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018053.2-884s1c1
Sequence:CCGGCTATTTCTCCTGGTTCAACGTCTCGAGACGTTGAACCAGGAGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018053.2-1845s1c1
Sequence:CCGGCGGGTTAGATCCCAAATGCTACTCGAGTAGCATTTGGGATCTAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018053.2-877s1c1
Sequence:CCGGCCATCCTCTATTTCTCCTGGTCTCGAGACCAGGAGAAATAGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018053.2-422s1c1
Sequence:CCGGCTCTGAGTTTGACTTGGCCTACTCGAGTAGGCCAAGTCAAACTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139576    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018053.2-1857s1c1
Sequence:CCGGCAAATGCTAGAAGCCAGGGATCTCGAGATCCCTGGCTTCTAGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018053.2-1750s1c1
Sequence:CCGGGCAGTTTATGTGCCAGGAACACTCGAGTGTTCCTGGCACATAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140878    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018053.2-1748s1c1
Sequence:CCGGGAGCAGTTTATGTGCCAGGAACTCGAGTTCCTGGCACATAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018053.2-1751s1c1
Sequence:CCGGCAGTTTATGTGCCAGGAACATCTCGAGATGTTCCTGGCACATAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018053.2-1763s1c1
Sequence:CCGGCAGGAACATCATTCTGTCCTTCTCGAGAAGGACAGAATGATGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018053
VALIDATED
XKR8 MISSION shRNA Lentiviral Transduction Particles
XK, Kell blood group complex subunit-related family, member 8
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018053.2-1708s1c1
Sequence:CCGGCCACACCATTCATTCAATTCACTCGAGTGAATTGAATGAATGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018053.2-1196s1c1
Sequence:CCGGCATGACCCATTTAGCACAGAACTCGAGTTCTGTGCTAAATGGGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018053.2-1199s1c1
Sequence:CCGGGACCCATTTAGCACAGAAGTTCTCGAGAACTTCTGTGCTAAATGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018053.2-884s1c1
Sequence:CCGGCTATTTCTCCTGGTTCAACGTCTCGAGACGTTGAACCAGGAGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018053.2-1845s1c1
Sequence:CCGGCGGGTTAGATCCCAAATGCTACTCGAGTAGCATTTGGGATCTAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018053.2-877s1c1
Sequence:CCGGCCATCCTCTATTTCTCCTGGTCTCGAGACCAGGAGAAATAGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018053.2-422s1c1
Sequence:CCGGCTCTGAGTTTGACTTGGCCTACTCGAGTAGGCCAAGTCAAACTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139576    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018053.2-1857s1c1
Sequence:CCGGCAAATGCTAGAAGCCAGGGATCTCGAGATCCCTGGCTTCTAGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018053.2-1750s1c1
Sequence:CCGGGCAGTTTATGTGCCAGGAACACTCGAGTGTTCCTGGCACATAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140878    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018053.2-1748s1c1
Sequence:CCGGGAGCAGTTTATGTGCCAGGAACTCGAGTTCCTGGCACATAAACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141625    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018053.2-1751s1c1
Sequence:CCGGCAGTTTATGTGCCAGGAACATCTCGAGATGTTCCTGGCACATAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018053.2-1763s1c1
Sequence:CCGGCAGGAACATCATTCTGTCCTTCTCGAGAAGGACAGAATGATGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201368
XKR8 MISSION shRNA Bacterial Glycerol Stock
XK, Kell blood group complex subunit-related family, member 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201368.1-584s1c1
Sequence:CCGGGCTCATCCTTTCTTGGCATCTCTCGAGAGATGCCAAGAAAGGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201368.1-882s1c1
Sequence:CCGGCATCCTCTATTTCTCCTGGTTCTCGAGAACCAGGAGAAATAGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201368.1-672s1c1
Sequence:CCGGGAGTTCCTCTGCTATCTACTTCTCGAGAAGTAGATAGCAGAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201368.1-1203s1c1
Sequence:CCGGCACCCTGTTAGCAGAGAACTTCTCGAGAAGTTCTCTGCTAACAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201368.1-1206s1c1
Sequence:CCGGCCTGTTAGCAGAGAACTTCTTCTCGAGAAGAAGTTCTCTGCTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201368
XKR8 MISSION shRNA shRNA Plasmid DNA
XK, Kell blood group complex subunit-related family, member 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201368.1-584s1c1
Sequence:CCGGGCTCATCCTTTCTTGGCATCTCTCGAGAGATGCCAAGAAAGGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201368.1-882s1c1
Sequence:CCGGCATCCTCTATTTCTCCTGGTTCTCGAGAACCAGGAGAAATAGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201368.1-672s1c1
Sequence:CCGGGAGTTCCTCTGCTATCTACTTCTCGAGAAGTAGATAGCAGAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201368.1-1203s1c1
Sequence:CCGGCACCCTGTTAGCAGAGAACTTCTCGAGAAGTTCTCTGCTAACAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201368.1-1206s1c1
Sequence:CCGGCCTGTTAGCAGAGAACTTCTTCTCGAGAAGAAGTTCTCTGCTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201368
XKR8 MISSION shRNA Lentiviral Transduction Particles
XK, Kell blood group complex subunit-related family, member 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201368.1-584s1c1
Sequence:CCGGGCTCATCCTTTCTTGGCATCTCTCGAGAGATGCCAAGAAAGGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201368.1-882s1c1
Sequence:CCGGCATCCTCTATTTCTCCTGGTTCTCGAGAACCAGGAGAAATAGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201368.1-672s1c1
Sequence:CCGGGAGTTCCTCTGCTATCTACTTCTCGAGAAGTAGATAGCAGAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201368.1-1203s1c1
Sequence:CCGGCACCCTGTTAGCAGAGAACTTCTCGAGAAGTTCTCTGCTAACAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201368.1-1206s1c1
Sequence:CCGGCCTGTTAGCAGAGAACTTCTTCTCGAGAAGAAGTTCTCTGCTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks