EMAIL THIS PAGE TO A FRIEND

XKR9

XK, Kell blood group complex subunit-related family, member 9

Synonyms: XRG9
UniProtKB ID: Q5GH70, B2RNS9, B9EH74
Gene ID:
Mouse(381246) X Kell blood group precursor related family member 9 homolog
Rat(497099) XK, Kell blood group complex subunit-related family, member 9
Zebrafish(678537) XK, Kell blood group complex subunit-related family, member 9
chicken(428363) XK, Kell blood group complex subunit-related family, member 9
domestic cat(101095397) XK, Kell blood group complex subunit-related family, member 9
dog(610280) XK, Kell blood group complex subunit-related family, member 9
cow(100300765) XK, Kell blood group complex subunit-related family, member 9
sheep(101105007) XK, Kell blood group complex subunit-related family, member 9
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA044430 Anti-XKR9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001011873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001011873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001011873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001011720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001011720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001011720 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU003711 MISSION® esiRNA esiRNA targeting mouse Xkr9 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011720 Rosetta Predictions human pricing
NM_001012229 Rosetta Predictions rat pricing
NM_001011873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243502 predicted 1182
2 SASI_Hs02_00306035 predicted 1325
3 SASI_Hs01_00243504 predicted 631
4 SASI_Hs01_00243506 predicted 1062
5 SASI_Hs01_00243507 predicted 1197
6 SASI_Hs01_00243508 predicted 599
7 SASI_Hs01_00243509 predicted 683
8 SASI_Hs01_00243510 predicted 1019
9 SASI_Hs01_00243511 predicted 885
10 SASI_Hs02_00306036 predicted 1534
11 SASI_Hs01_00243503 predicted 723
12 SASI_Hs01_00243505 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012229 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089312 predicted 739
2 SASI_Rn01_00089313 predicted 826
3 SASI_Rn01_00089314 predicted 957
4 SASI_Rn01_00089315 predicted 552
5 SASI_Rn01_00089316 predicted 541
6 SASI_Rn01_00089317 predicted 527
7 SASI_Rn01_00089318 predicted 1076
8 SASI_Rn01_00089319 predicted 1228
9 SASI_Rn01_00089320 predicted 561
10 SASI_Rn01_00089321 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028204 predicted 1191
2 SASI_Mm01_00028205 predicted 610
3 SASI_Mm01_00028206 predicted 1057
4 SASI_Mm01_00028207 predicted 1224
5 SASI_Mm02_00287047 predicted 728
6 SASI_Mm02_00287048 predicted 1092
7 SASI_Mm01_00028209 predicted 566
8 SASI_Mm01_00028210 predicted 993
9 SASI_Mm01_00028211 predicted 1057
10 SASI_Mm01_00028212 predicted 1320
11 SASI_Mm01_00028208 predicted 828
12 SASI_Mm01_00028213 predicted 663
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011873
XKR9 MISSION shRNA Bacterial Glycerol Stock
XK, Kell blood group complex subunit-related family, member 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011873.1-1681s1c1
Sequence:CCGGCCTCTGTCTGAAATGAGTTATCTCGAGATAACTCATTTCAGACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011873.1-1064s1c1
Sequence:CCGGGCCCAAACTCATGTATCTCTTCTCGAGAAGAGATACATGAGTTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011873.1-1543s1c1
Sequence:CCGGCACCTCAGAGAGATTGTAGAACTCGAGTTCTACAATCTCTCTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011873.1-1431s1c1
Sequence:CCGGGCCACCATAGTTCTTGCTCTTCTCGAGAAGAGCAAGAACTATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011873.1-1318s1c1
Sequence:CCGGGCCCAATGTCTTGTTATTATACTCGAGTATAATAACAAGACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011873
XKR9 MISSION shRNA shRNA Plasmid DNA
XK, Kell blood group complex subunit-related family, member 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011873.1-1681s1c1
Sequence:CCGGCCTCTGTCTGAAATGAGTTATCTCGAGATAACTCATTTCAGACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011873.1-1064s1c1
Sequence:CCGGGCCCAAACTCATGTATCTCTTCTCGAGAAGAGATACATGAGTTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011873.1-1543s1c1
Sequence:CCGGCACCTCAGAGAGATTGTAGAACTCGAGTTCTACAATCTCTCTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011873.1-1431s1c1
Sequence:CCGGGCCACCATAGTTCTTGCTCTTCTCGAGAAGAGCAAGAACTATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011873.1-1318s1c1
Sequence:CCGGGCCCAATGTCTTGTTATTATACTCGAGTATAATAACAAGACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011873
XKR9 MISSION shRNA Lentiviral Transduction Particles
XK, Kell blood group complex subunit-related family, member 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011873.1-1681s1c1
Sequence:CCGGCCTCTGTCTGAAATGAGTTATCTCGAGATAACTCATTTCAGACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011873.1-1064s1c1
Sequence:CCGGGCCCAAACTCATGTATCTCTTCTCGAGAAGAGATACATGAGTTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011873.1-1543s1c1
Sequence:CCGGCACCTCAGAGAGATTGTAGAACTCGAGTTCTACAATCTCTCTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011873.1-1431s1c1
Sequence:CCGGGCCACCATAGTTCTTGCTCTTCTCGAGAAGAGCAAGAACTATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011873.1-1318s1c1
Sequence:CCGGGCCCAATGTCTTGTTATTATACTCGAGTATAATAACAAGACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011720
XKR9 MISSION shRNA Bacterial Glycerol Stock
XK, Kell blood group complex subunit-related family, member 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011720.1-609s1c1
Sequence:CCGGCATATGGGTATCTGTCAGATTCTCGAGAATCTGACAGATACCCATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011720.1-561s1c1
Sequence:CCGGGATGTCAGTTCTTGGCATTATCTCGAGATAATGCCAAGAACTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011720.1-1568s1c1
Sequence:CCGGCAAACAGAAGTGCAGAAACAACTCGAGTTGTTTCTGCACTTCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011720.1-2587s1c1
Sequence:CCGGCCAGATTTCATGTGTGTGAAACTCGAGTTTCACACACATGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011720.1-1186s1c1
Sequence:CCGGCTGAGTGTTGTACTTCTACTACTCGAGTAGTAGAAGTACAACACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011720.1-730s1c1
Sequence:CCGGGATTTAAAGAAAGCAGGCCAACTCGAGTTGGCCTGCTTTCTTTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001011720.1-1782s21c1
Sequence:CCGGAGGAGATACATAGTAGTATTTCTCGAGAAATACTACTATGTATCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011720.1-1386s21c1
Sequence:CCGGGTGTCCAATGTCTTGTTATTACTCGAGTAATAACAAGACATTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011720
XKR9 MISSION shRNA shRNA Plasmid DNA
XK, Kell blood group complex subunit-related family, member 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011720.1-609s1c1
Sequence:CCGGCATATGGGTATCTGTCAGATTCTCGAGAATCTGACAGATACCCATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011720.1-561s1c1
Sequence:CCGGGATGTCAGTTCTTGGCATTATCTCGAGATAATGCCAAGAACTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011720.1-1568s1c1
Sequence:CCGGCAAACAGAAGTGCAGAAACAACTCGAGTTGTTTCTGCACTTCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011720.1-2587s1c1
Sequence:CCGGCCAGATTTCATGTGTGTGAAACTCGAGTTTCACACACATGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011720.1-1186s1c1
Sequence:CCGGCTGAGTGTTGTACTTCTACTACTCGAGTAGTAGAAGTACAACACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011720.1-730s1c1
Sequence:CCGGGATTTAAAGAAAGCAGGCCAACTCGAGTTGGCCTGCTTTCTTTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001011720.1-1782s21c1
Sequence:CCGGAGGAGATACATAGTAGTATTTCTCGAGAAATACTACTATGTATCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011720.1-1386s21c1
Sequence:CCGGGTGTCCAATGTCTTGTTATTACTCGAGTAATAACAAGACATTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011720
XKR9 MISSION shRNA Lentiviral Transduction Particles
XK, Kell blood group complex subunit-related family, member 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011720.1-609s1c1
Sequence:CCGGCATATGGGTATCTGTCAGATTCTCGAGAATCTGACAGATACCCATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011720.1-561s1c1
Sequence:CCGGGATGTCAGTTCTTGGCATTATCTCGAGATAATGCCAAGAACTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011720.1-1568s1c1
Sequence:CCGGCAAACAGAAGTGCAGAAACAACTCGAGTTGTTTCTGCACTTCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011720.1-2587s1c1
Sequence:CCGGCCAGATTTCATGTGTGTGAAACTCGAGTTTCACACACATGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001011720.1-1186s1c1
Sequence:CCGGCTGAGTGTTGTACTTCTACTACTCGAGTAGTAGAAGTACAACACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011720.1-730s1c1
Sequence:CCGGGATTTAAAGAAAGCAGGCCAACTCGAGTTGGCCTGCTTTCTTTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001011720.1-1782s21c1
Sequence:CCGGAGGAGATACATAGTAGTATTTCTCGAGAAATACTACTATGTATCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011720.1-1386s21c1
Sequence:CCGGGTGTCCAATGTCTTGTTATTACTCGAGTAATAACAAGACATTGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks