EMAIL THIS PAGE TO A FRIEND

XKRX

XK, Kell blood group complex subunit-related, X-linked

Synonyms: XKR2 XPLAC XRG2
UniProtKB ID: Q6PP77, B2RNN6, B4DKU2, Q5H9J6
Gene ID:
Human(402415) Summary: This gene encodes a protein that is related to a component of the XK/Kell complex of the Kell blood group system. The encoded protein includes several transmembrane domains, is known to be exposed to the cell surface, and may function as a membrane transporter. [provided by RefSeq, May 2010]
Mouse(331524) X Kell blood group precursor related X linked
Rat(497101) XK, Kell blood group complex subunit-related, X-linked
domestic guinea pig(100719790) XK, Kell blood group complex subunit-related, X-linked
naked mole-rat(101720197) XK, Kell blood group complex subunit-related, X-linked
cow(524975) XK, Kell blood group complex subunit-related, X-linked
sheep(101104045) XK, Kell blood group complex subunit-related, X-linked
Zebrafish(492765) XK, Kell blood group complex subunit-related, X-linked
chicken(771005) XK, Kell blood group complex subunit-related, X-linked
Horse(100060004) XK, Kell blood group complex subunit-related, X-linked
domestic cat(101090924) XK, Kell blood group complex subunit-related, X-linked
dog(609590) XK, Kell blood group complex subunit-related, X-linked
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_212559 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_212559 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_212559 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183319 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183319 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183319 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142931 MISSION® esiRNA esiRNA human XKRX (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_212559 Rosetta Predictions human pricing
NM_001012230 Rosetta Predictions rat pricing
NM_183319 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221282 predicted 569
2 SASI_Hs02_00374254 predicted 939
3 SASI_Hs01_00221283 predicted 784
4 SASI_Hs01_00221284 predicted 873
5 SASI_Hs01_00221285 predicted 600
6 SASI_Hs01_00221286 predicted 1080
7 SASI_Hs02_00374255 predicted 1377
8 SASI_Hs01_00221288 predicted 2033
9 SASI_Hs01_00221289 predicted 1200
10 SASI_Hs01_00221290 predicted 1899
11 SASI_Hs01_00221287 predicted 1016
12 SASI_Hs01_00221291 predicted 1615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097581 predicted 449
2 SASI_Rn01_00097582 predicted 266
3 SASI_Rn02_00200495 predicted 386
4 SASI_Rn01_00097583 predicted 595
5 SASI_Rn01_00097584 predicted 520
6 SASI_Rn01_00097586 predicted 992
7 SASI_Rn01_00097587 predicted 861
8 SASI_Rn01_00097588 predicted 409
9 SASI_Rn01_00097589 predicted 775
10 SASI_Rn01_00097590 predicted 734
11 SASI_Rn01_00097585 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350445 predicted 513
2 SASI_Mm02_00350446 predicted 1051
3 SASI_Mm02_00350447 predicted 293
4 SASI_Mm02_00350448 predicted 893
5 SASI_Mm02_00350449 predicted 689
6 SASI_Mm02_00350450 predicted 1008
7 SASI_Mm02_00350451 predicted 850
8 SASI_Mm02_00350452 predicted 239
9 SASI_Mm02_00350453 predicted 575
10 SASI_Mm02_00350454 predicted 1134
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212559
XKRX MISSION shRNA Bacterial Glycerol Stock
XK, Kell blood group complex subunit-related, X-linked
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212559.2-887s21c1
Sequence:CCGGAGATAAACCGCTATCATTATTCTCGAGAATAATGATAGCGGTTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212559.2-1093s21c1
Sequence:CCGGTGCACCGCAATGCCTACAAACCTCGAGGTTTGTAGGCATTGCGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212559.1-598s1c1
Sequence:CCGGCCTCGACAATGGACAGAGTTTCTCGAGAAACTCTGTCCATTGTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212559.1-1013s1c1
Sequence:CCGGCACCCGAAAGAAGATGCTAATCTCGAGATTAGCATCTTCTTTCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212559.1-1272s1c1
Sequence:CCGGGCTATCCAGATCAAGTACGATCTCGAGATCGTACTTGATCTGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212559.1-2243s1c1
Sequence:CCGGGCTCTCTAAAGTGACCTTCTACTCGAGTAGAAGGTCACTTTAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000455043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212559.2-1332s21c1
Sequence:CCGGATCACCATCTGGCGGACATTGCTCGAGCAATGTCCGCCAGATGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212559.1-2385s1c1
Sequence:CCGGCCCAGGAAACAGTCTGACTAACTCGAGTTAGTCAGACTGTTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212559.1-2698s1c1
Sequence:CCGGCCTCTCACTTAGTGCCTCATTCTCGAGAATGAGGCACTAAGTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212559.1-1611s1c1
Sequence:CCGGGACAGAGATCTCGTCGACAAACTCGAGTTTGTCGACGAGATCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212559.1-1199s1c1
Sequence:CCGGCCTGGGTAGAGTTGTGCTAATCTCGAGATTAGCACAACTCTACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212559
XKRX MISSION shRNA shRNA Plasmid DNA
XK, Kell blood group complex subunit-related, X-linked
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212559.2-887s21c1
Sequence:CCGGAGATAAACCGCTATCATTATTCTCGAGAATAATGATAGCGGTTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212559.2-1093s21c1
Sequence:CCGGTGCACCGCAATGCCTACAAACCTCGAGGTTTGTAGGCATTGCGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212559.1-598s1c1
Sequence:CCGGCCTCGACAATGGACAGAGTTTCTCGAGAAACTCTGTCCATTGTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212559.1-1013s1c1
Sequence:CCGGCACCCGAAAGAAGATGCTAATCTCGAGATTAGCATCTTCTTTCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212559.1-1272s1c1
Sequence:CCGGGCTATCCAGATCAAGTACGATCTCGAGATCGTACTTGATCTGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212559.1-2243s1c1
Sequence:CCGGGCTCTCTAAAGTGACCTTCTACTCGAGTAGAAGGTCACTTTAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000455043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212559.2-1332s21c1
Sequence:CCGGATCACCATCTGGCGGACATTGCTCGAGCAATGTCCGCCAGATGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212559.1-2385s1c1
Sequence:CCGGCCCAGGAAACAGTCTGACTAACTCGAGTTAGTCAGACTGTTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212559.1-2698s1c1
Sequence:CCGGCCTCTCACTTAGTGCCTCATTCTCGAGAATGAGGCACTAAGTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212559.1-1611s1c1
Sequence:CCGGGACAGAGATCTCGTCGACAAACTCGAGTTTGTCGACGAGATCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212559.1-1199s1c1
Sequence:CCGGCCTGGGTAGAGTTGTGCTAATCTCGAGATTAGCACAACTCTACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212559
XKRX MISSION shRNA Lentiviral Transduction Particles
XK, Kell blood group complex subunit-related, X-linked
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212559.2-887s21c1
Sequence:CCGGAGATAAACCGCTATCATTATTCTCGAGAATAATGATAGCGGTTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212559.2-1093s21c1
Sequence:CCGGTGCACCGCAATGCCTACAAACCTCGAGGTTTGTAGGCATTGCGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212559.1-598s1c1
Sequence:CCGGCCTCGACAATGGACAGAGTTTCTCGAGAAACTCTGTCCATTGTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212559.1-1013s1c1
Sequence:CCGGCACCCGAAAGAAGATGCTAATCTCGAGATTAGCATCTTCTTTCGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212559.1-1272s1c1
Sequence:CCGGGCTATCCAGATCAAGTACGATCTCGAGATCGTACTTGATCTGGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212559.1-2243s1c1
Sequence:CCGGGCTCTCTAAAGTGACCTTCTACTCGAGTAGAAGGTCACTTTAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000455043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212559.2-1332s21c1
Sequence:CCGGATCACCATCTGGCGGACATTGCTCGAGCAATGTCCGCCAGATGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212559.1-2385s1c1
Sequence:CCGGCCCAGGAAACAGTCTGACTAACTCGAGTTAGTCAGACTGTTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212559.1-2698s1c1
Sequence:CCGGCCTCTCACTTAGTGCCTCATTCTCGAGAATGAGGCACTAAGTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212559.1-1611s1c1
Sequence:CCGGGACAGAGATCTCGTCGACAAACTCGAGTTTGTCGACGAGATCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212559.1-1199s1c1
Sequence:CCGGCCTGGGTAGAGTTGTGCTAATCTCGAGATTAGCACAACTCTACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183319
XKRX MISSION shRNA Bacterial Glycerol Stock
XK, Kell blood group complex subunit-related, X-linked
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183319.2-2235s1c1
Sequence:CCGGGCTGGGATATTTGTATTCTAACTCGAGTTAGAATACAAATATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183319.2-1242s1c1
Sequence:CCGGGCGCTCACTCTTCACCAATAACTCGAGTTATTGGTGAAGAGTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183319.2-255s1c1
Sequence:CCGGCATGGTTCAGTTGACCCTCATCTCGAGATGAGGGTCAACTGAACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183319.2-669s1c1
Sequence:CCGGCCTGTGCAATATGTTGGCTATCTCGAGATAGCCAACATATTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183319.2-169s1c1
Sequence:CCGGGCTTTGTACATGGTTAGAATTCTCGAGAATTCTAACCATGTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183319
XKRX MISSION shRNA shRNA Plasmid DNA
XK, Kell blood group complex subunit-related, X-linked
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183319.2-2235s1c1
Sequence:CCGGGCTGGGATATTTGTATTCTAACTCGAGTTAGAATACAAATATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183319.2-1242s1c1
Sequence:CCGGGCGCTCACTCTTCACCAATAACTCGAGTTATTGGTGAAGAGTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183319.2-255s1c1
Sequence:CCGGCATGGTTCAGTTGACCCTCATCTCGAGATGAGGGTCAACTGAACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183319.2-669s1c1
Sequence:CCGGCCTGTGCAATATGTTGGCTATCTCGAGATAGCCAACATATTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183319.2-169s1c1
Sequence:CCGGGCTTTGTACATGGTTAGAATTCTCGAGAATTCTAACCATGTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183319
XKRX MISSION shRNA Lentiviral Transduction Particles
XK, Kell blood group complex subunit-related, X-linked
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183319.2-2235s1c1
Sequence:CCGGGCTGGGATATTTGTATTCTAACTCGAGTTAGAATACAAATATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183319.2-1242s1c1
Sequence:CCGGGCGCTCACTCTTCACCAATAACTCGAGTTATTGGTGAAGAGTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183319.2-255s1c1
Sequence:CCGGCATGGTTCAGTTGACCCTCATCTCGAGATGAGGGTCAACTGAACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183319.2-669s1c1
Sequence:CCGGCCTGTGCAATATGTTGGCTATCTCGAGATAGCCAACATATTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183319.2-169s1c1
Sequence:CCGGGCTTTGTACATGGTTAGAATTCTCGAGAATTCTAACCATGTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks