EMAIL THIS PAGE TO A FRIEND

XKRY2

XK, Kell blood group complex subunit-related, Y-linked 2

Synonyms: XKRYP7
Species: Human XKRY2(353515)
UniProtKB ID: A2RUG3
Gene ID:
Human(353515) Summary: This gene is located in the nonrecombining portion of the Y chromosome, and is expressed specifically in testis. It encodes a protein which is similar to XK (X-linked Kell blood group precursor), a putative membrane transport protein. This gene is present as two identical copies within a palindromic region; this record represents the more telomeric copy. [provided by RefSeq, Jul 2008]
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002906 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002906 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002906 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002906 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304252 predicted 878
2 SASI_Hs01_00019513 predicted 948
3 SASI_Hs02_00304253 predicted 1262
4 SASI_Hs01_00019514 predicted 767
5 SASI_Hs01_00019515 predicted 880
6 SASI_Hs01_00019516 predicted 761
7 SASI_Hs01_00019517 predicted 1202
8 SASI_Hs01_00019518 predicted 768
9 SASI_Hs01_00019519 predicted 1081
10 SASI_Hs01_00019520 predicted 1108
11 SASI_Hs01_00019512 predicted 1001
12 SASI_Hs01_00019521 predicted 999
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002906
XKRY2 MISSION shRNA Bacterial Glycerol Stock
XK, Kell blood group complex subunit-related, Y-linked 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002906.1-770s1c1
Sequence:CCGGCCATTAAGCTACAGGTGATAACTCGAGTTATCACCTGTAGCTTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-855s1c1
Sequence:CCGGCTTCCCTGCATCTCTGAAACACTCGAGTGTTTCAGAGATGCAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-947s1c1
Sequence:CCGGGTGGAACTCATCTTCCTAGCACTCGAGTGCTAGGAAGATGAGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-755s1c1
Sequence:CCGGGCAACGACTTTGCTGCCATTACTCGAGTAATGGCAGCAAAGTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002906.1-1263s1c1
Sequence:CCGGGCTCCGCTTCTGTCAGTATTTCTCGAGAAATACTGACAGAAGCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-953s1c1
Sequence:CCGGCTCATCTTCCTAGCAACACAACTCGAGTTGTGTTGCTAGGAAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-819s1c1
Sequence:CCGGGTTGGTGATTATCTCACCTGTCTCGAGACAGGTGAGATAATCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002906.1-1301s1c1
Sequence:CCGGGCAAAGTATTGCCAGGAGATACTCGAGTATCTCCTGGCAATACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002906.1-807s1c1
Sequence:CCGGGATATGGCATTCGTTGGTGATCTCGAGATCACCAACGAATGCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002906.1-1022s1c1
Sequence:CCGGGCTAGTATATGCTGCCATCAACTCGAGTTGATGGCAGCATATACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002906.1-1196s1c1
Sequence:CCGGCGAAGTGTTGTGACTCAATAACTCGAGTTATTGAGTCACAACACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-814s1c1
Sequence:CCGGCATTCGTTGGTGATTATCTCACTCGAGTGAGATAATCACCAACGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002906
XKRY2 MISSION shRNA shRNA Plasmid DNA
XK, Kell blood group complex subunit-related, Y-linked 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002906.1-770s1c1
Sequence:CCGGCCATTAAGCTACAGGTGATAACTCGAGTTATCACCTGTAGCTTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-855s1c1
Sequence:CCGGCTTCCCTGCATCTCTGAAACACTCGAGTGTTTCAGAGATGCAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-947s1c1
Sequence:CCGGGTGGAACTCATCTTCCTAGCACTCGAGTGCTAGGAAGATGAGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-755s1c1
Sequence:CCGGGCAACGACTTTGCTGCCATTACTCGAGTAATGGCAGCAAAGTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002906.1-1263s1c1
Sequence:CCGGGCTCCGCTTCTGTCAGTATTTCTCGAGAAATACTGACAGAAGCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-953s1c1
Sequence:CCGGCTCATCTTCCTAGCAACACAACTCGAGTTGTGTTGCTAGGAAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-819s1c1
Sequence:CCGGGTTGGTGATTATCTCACCTGTCTCGAGACAGGTGAGATAATCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002906.1-1301s1c1
Sequence:CCGGGCAAAGTATTGCCAGGAGATACTCGAGTATCTCCTGGCAATACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002906.1-807s1c1
Sequence:CCGGGATATGGCATTCGTTGGTGATCTCGAGATCACCAACGAATGCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002906.1-1022s1c1
Sequence:CCGGGCTAGTATATGCTGCCATCAACTCGAGTTGATGGCAGCATATACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002906.1-1196s1c1
Sequence:CCGGCGAAGTGTTGTGACTCAATAACTCGAGTTATTGAGTCACAACACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-814s1c1
Sequence:CCGGCATTCGTTGGTGATTATCTCACTCGAGTGAGATAATCACCAACGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002906
XKRY2 MISSION shRNA Lentiviral Transduction Particles
XK, Kell blood group complex subunit-related, Y-linked 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002906.1-770s1c1
Sequence:CCGGCCATTAAGCTACAGGTGATAACTCGAGTTATCACCTGTAGCTTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-855s1c1
Sequence:CCGGCTTCCCTGCATCTCTGAAACACTCGAGTGTTTCAGAGATGCAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-947s1c1
Sequence:CCGGGTGGAACTCATCTTCCTAGCACTCGAGTGCTAGGAAGATGAGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-755s1c1
Sequence:CCGGGCAACGACTTTGCTGCCATTACTCGAGTAATGGCAGCAAAGTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002906.1-1263s1c1
Sequence:CCGGGCTCCGCTTCTGTCAGTATTTCTCGAGAAATACTGACAGAAGCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-953s1c1
Sequence:CCGGCTCATCTTCCTAGCAACACAACTCGAGTTGTGTTGCTAGGAAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-819s1c1
Sequence:CCGGGTTGGTGATTATCTCACCTGTCTCGAGACAGGTGAGATAATCACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002906.1-1301s1c1
Sequence:CCGGGCAAAGTATTGCCAGGAGATACTCGAGTATCTCCTGGCAATACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002906.1-807s1c1
Sequence:CCGGGATATGGCATTCGTTGGTGATCTCGAGATCACCAACGAATGCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002906.1-1022s1c1
Sequence:CCGGGCTAGTATATGCTGCCATCAACTCGAGTTGATGGCAGCATATACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002906.1-1196s1c1
Sequence:CCGGCGAAGTGTTGTGACTCAATAACTCGAGTTATTGAGTCACAACACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002906.1-814s1c1
Sequence:CCGGCATTCGTTGGTGATTATCTCACTCGAGTGAGATAATCACCAACGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks