EMAIL THIS PAGE TO A FRIEND

XKRY

XK, Kell blood group complex subunit-related, Y-linked

Synonyms: XKRY1
Species: Human XKRY(9082)
UniProtKB ID: O14609
Gene ID:
Human(9082) Summary: This gene is located in the nonrecombining portion of the Y chromosome, and is expressed specifically in testis. It encodes a protein which is similar to XK (X-linked Kell blood group precursor), a putative membrane transport protein. This gene is present as two identical copies within a palindromic region; this record represents the more centromeric copy. [provided by RefSeq, Jul 2008]
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004677 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004677 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338108 predicted 886
2 SASI_Hs01_00019433 predicted 949
3 SASI_Hs02_00338109 predicted 1262
4 SASI_Hs01_00019434 predicted 761
5 SASI_Hs01_00019435 predicted 871
6 SASI_Hs01_00019436 predicted 769
7 SASI_Hs01_00019437 predicted 1206
8 SASI_Hs01_00019438 predicted 768
9 SASI_Hs01_00019439 predicted 1075
10 SASI_Hs01_00019440 predicted 1103
11 SASI_Hs01_00019432 predicted 1001
12 SASI_Hs01_00019441 predicted 997
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004677
XKRY MISSION shRNA Bacterial Glycerol Stock
XK, Kell blood group complex subunit-related, Y-linked
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004677.1-715s1c1
Sequence:CCGGGTAGGTGCCATTCACTGCAATCTCGAGATTGCAGTGAATGGCACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004677.1-755s1c1
Sequence:CCGGGCAACGACTTTGCTGCCATTACTCGAGTAATGGCAGCAAAGTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004677.1-807s1c1
Sequence:CCGGGATATGGCATTCGTTGGTGATCTCGAGATCACCAACGAATGCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163142    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004677.1-1101s1c1
Sequence:CCGGGAGGTGGGACATACAATCCTACTCGAGTAGGATTGTATGTCCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161496    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004677.1-1021s1c1
Sequence:CCGGGCTAGTATATGCTGCCATCAACTCGAGTTGATGGCAGCATATACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004677.1-953s1c1
Sequence:CCGGCTCATCTTCCTAGCAACACAACTCGAGTTGTGTTGCTAGGAAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004677.1-700s1c1
Sequence:CCGGCCTCTTATCAGTTGTGTAGGTCTCGAGACCTACACAACTGATAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004677.2-998s21c1
Sequence:CCGGAGTATGGATGCTTATCTTAATCTCGAGATTAAGATAAGCATCCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004677.2-879s21c1
Sequence:CCGGGAGCTTACACTTTCTATTAATCTCGAGATTAATAGAAAGTGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004677.2-1195s21c1
Sequence:CCGGCCGAAGTGTTGTGACTCAATACTCGAGTATTGAGTCACAACACTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004677.2-756s21c1
Sequence:CCGGCAACGACTTTGCTGCCATTAACTCGAGTTAATGGCAGCAAAGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004677
XKRY MISSION shRNA shRNA Plasmid DNA
XK, Kell blood group complex subunit-related, Y-linked
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004677.1-715s1c1
Sequence:CCGGGTAGGTGCCATTCACTGCAATCTCGAGATTGCAGTGAATGGCACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004677.1-755s1c1
Sequence:CCGGGCAACGACTTTGCTGCCATTACTCGAGTAATGGCAGCAAAGTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004677.1-807s1c1
Sequence:CCGGGATATGGCATTCGTTGGTGATCTCGAGATCACCAACGAATGCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163142    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004677.1-1101s1c1
Sequence:CCGGGAGGTGGGACATACAATCCTACTCGAGTAGGATTGTATGTCCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161496    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004677.1-1021s1c1
Sequence:CCGGGCTAGTATATGCTGCCATCAACTCGAGTTGATGGCAGCATATACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004677.1-953s1c1
Sequence:CCGGCTCATCTTCCTAGCAACACAACTCGAGTTGTGTTGCTAGGAAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004677.1-700s1c1
Sequence:CCGGCCTCTTATCAGTTGTGTAGGTCTCGAGACCTACACAACTGATAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004677.2-998s21c1
Sequence:CCGGAGTATGGATGCTTATCTTAATCTCGAGATTAAGATAAGCATCCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004677.2-879s21c1
Sequence:CCGGGAGCTTACACTTTCTATTAATCTCGAGATTAATAGAAAGTGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004677.2-1195s21c1
Sequence:CCGGCCGAAGTGTTGTGACTCAATACTCGAGTATTGAGTCACAACACTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004677.2-756s21c1
Sequence:CCGGCAACGACTTTGCTGCCATTAACTCGAGTTAATGGCAGCAAAGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004677
XKRY MISSION shRNA Lentiviral Transduction Particles
XK, Kell blood group complex subunit-related, Y-linked
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004677.1-715s1c1
Sequence:CCGGGTAGGTGCCATTCACTGCAATCTCGAGATTGCAGTGAATGGCACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004677.1-755s1c1
Sequence:CCGGGCAACGACTTTGCTGCCATTACTCGAGTAATGGCAGCAAAGTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004677.1-807s1c1
Sequence:CCGGGATATGGCATTCGTTGGTGATCTCGAGATCACCAACGAATGCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163142    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004677.1-1101s1c1
Sequence:CCGGGAGGTGGGACATACAATCCTACTCGAGTAGGATTGTATGTCCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161496    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004677.1-1021s1c1
Sequence:CCGGGCTAGTATATGCTGCCATCAACTCGAGTTGATGGCAGCATATACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004677.1-953s1c1
Sequence:CCGGCTCATCTTCCTAGCAACACAACTCGAGTTGTGTTGCTAGGAAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004677.1-700s1c1
Sequence:CCGGCCTCTTATCAGTTGTGTAGGTCTCGAGACCTACACAACTGATAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004677.2-998s21c1
Sequence:CCGGAGTATGGATGCTTATCTTAATCTCGAGATTAAGATAAGCATCCATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004677.2-879s21c1
Sequence:CCGGGAGCTTACACTTTCTATTAATCTCGAGATTAATAGAAAGTGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004677.2-1195s21c1
Sequence:CCGGCCGAAGTGTTGTGACTCAATACTCGAGTATTGAGTCACAACACTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004677.2-756s21c1
Sequence:CCGGCAACGACTTTGCTGCCATTAACTCGAGTTAATGGCAGCAAAGTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks