EMAIL THIS PAGE TO A FRIEND

XPA

xeroderma pigmentosum, complementation group A

Synonyms: XP1 XPAC
UniProtKB ID: P23025, Q5T1U9, Q6LCW7, Q6LD02
Gene ID:
Human(7507) Summary: This gene encodes a zinc finger protein involved in DNA excision repair. The encoded protein is part of the NER (nucleotide excision repair) complext which is responsible for repair of UV radiation-induced photoproducts and DNA adducts induced by chemical carcinogens. Mutations in this gene are associated with xeroderma pigmentosum complementation group A. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(22590) xeroderma pigmentosum, complementation group A
Rat(298074) xeroderma pigmentosum, complementation group A
Zebrafish(393443) xeroderma pigmentosum, complementation group A
domestic cat(101091820) xeroderma pigmentosum, complementation group A
dog(481623) xeroderma pigmentosum, complementation group A
chicken(395659) xeroderma pigmentosum, complementation group A
cow(537958) xeroderma pigmentosum, complementation group A
sheep(101103949) xeroderma pigmentosum, complementation group A
domestic guinea pig(100735836) xeroderma pigmentosum, complementation group A
naked mole-rat(101726488) xeroderma pigmentosum, complementation group A
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000380 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000380 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000380 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011728 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011728 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011728 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000380 Rosetta Predictions human pricing
NM_001106656 Rosetta Predictions rat pricing
NM_011728 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302440 predicted 441
2 SASI_Hs02_00302441 predicted 455
3 SASI_Hs01_00233868 predicted 473
4 SASI_Hs01_00233870 predicted 277
5 SASI_Hs02_00302442 predicted 396
6 SASI_Hs01_00233875 predicted 1233
7 SASI_Hs02_00302443 predicted 474
8 SASI_Hs02_00302444 predicted 470
9 SASI_Hs02_00302445 predicted 276
10 SASI_Hs02_00302446 predicted 1227
11 SASI_Hs01_00233866 predicted 451
12 SASI_Hs01_00233867 predicted 545
13 SASI_Hs01_00233869 predicted 1183
14 SASI_Hs01_00233871 predicted 421
15 SASI_Hs01_00233872 predicted 619
16 SASI_Hs01_00233873 predicted 604
17 SASI_Hs01_00233874 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221098 predicted 438
2 SASI_Rn02_00221099 predicted 802
3 SASI_Rn02_00221100 predicted 579
4 SASI_Rn02_00221101 predicted 593
5 SASI_Rn02_00221102 predicted 261
6 SASI_Rn02_00221103 predicted 444
7 SASI_Rn02_00221104 predicted 552
8 SASI_Rn02_00221105 predicted 393
9 SASI_Rn02_00221106 predicted 412
10 SASI_Rn02_00221107 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321298 predicted 634
2 SASI_Mm01_00078389 predicted 608
3 SASI_Mm01_00078390 predicted 296
4 SASI_Mm01_00078391 predicted 450
5 SASI_Mm01_00078392 predicted 470
6 SASI_Mm01_00078393 predicted 477
7 SASI_Mm01_00078394 predicted 516
8 SASI_Mm01_00078395 predicted 425
9 SASI_Mm01_00078396 predicted 340
10 SASI_Mm01_00078398 predicted 627
11 SASI_Mm01_00078397 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000380
VALIDATED
XPA MISSION shRNA Bacterial Glycerol Stock
xeroderma pigmentosum, complementation group A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000380.2-1087s1c1
Sequence:CCGGGCACAATGTCATGTCTGTGATCTCGAGATCACAGACATGACATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000380.2-795s1c1
Sequence:CCGGCATGAGTATGGACCAGAAGAACTCGAGTTCTTCTGGTCCATACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000380.2-349s1c1
Sequence:CCGGGACCTGTTATGGAATTTGATTCTCGAGAATCAAATTCCATAACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000380.2-459s1c1
Sequence:CCGGGCTGATGATAAACACAAGCTTCTCGAGAAGCTTGTGTTTATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000380.2-660s1c1
Sequence:CCGGGCATTAGAAGAAGCAAAGGAACTCGAGTTCCTTTGCTTCTTCTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000380.3-644s21c1
Sequence:CCGGGTGATATGAAACTCTACTTAACTCGAGTTAAGTAGAGTTTCATATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_000380.3-1210s21c1
Sequence:CCGGTGGTAGGTCAGCTACAAATTTCTCGAGAAATTTGTAGCTGACCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_000380.3-1242s21c1
Sequence:CCGGACCAAGGCAAACCCTAGATTGCTCGAGCAATCTAGGGTTTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000380.3-514s21c1
Sequence:CCGGGATGATAAACACAAGCTTATACTCGAGTATAAGCTTGTGTTTATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000380
VALIDATED
XPA MISSION shRNA shRNA Plasmid DNA
xeroderma pigmentosum, complementation group A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000380.2-1087s1c1
Sequence:CCGGGCACAATGTCATGTCTGTGATCTCGAGATCACAGACATGACATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000380.2-795s1c1
Sequence:CCGGCATGAGTATGGACCAGAAGAACTCGAGTTCTTCTGGTCCATACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000380.2-349s1c1
Sequence:CCGGGACCTGTTATGGAATTTGATTCTCGAGAATCAAATTCCATAACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000380.2-459s1c1
Sequence:CCGGGCTGATGATAAACACAAGCTTCTCGAGAAGCTTGTGTTTATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000380.2-660s1c1
Sequence:CCGGGCATTAGAAGAAGCAAAGGAACTCGAGTTCCTTTGCTTCTTCTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000380.3-644s21c1
Sequence:CCGGGTGATATGAAACTCTACTTAACTCGAGTTAAGTAGAGTTTCATATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_000380.3-1210s21c1
Sequence:CCGGTGGTAGGTCAGCTACAAATTTCTCGAGAAATTTGTAGCTGACCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_000380.3-1242s21c1
Sequence:CCGGACCAAGGCAAACCCTAGATTGCTCGAGCAATCTAGGGTTTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000380.3-514s21c1
Sequence:CCGGGATGATAAACACAAGCTTATACTCGAGTATAAGCTTGTGTTTATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000380
VALIDATED
XPA MISSION shRNA Lentiviral Transduction Particles
xeroderma pigmentosum, complementation group A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000380.2-1087s1c1
Sequence:CCGGGCACAATGTCATGTCTGTGATCTCGAGATCACAGACATGACATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000380.2-795s1c1
Sequence:CCGGCATGAGTATGGACCAGAAGAACTCGAGTTCTTCTGGTCCATACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000380.2-349s1c1
Sequence:CCGGGACCTGTTATGGAATTTGATTCTCGAGAATCAAATTCCATAACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000380.2-459s1c1
Sequence:CCGGGCTGATGATAAACACAAGCTTCTCGAGAAGCTTGTGTTTATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000380.2-660s1c1
Sequence:CCGGGCATTAGAAGAAGCAAAGGAACTCGAGTTCCTTTGCTTCTTCTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000380.3-644s21c1
Sequence:CCGGGTGATATGAAACTCTACTTAACTCGAGTTAAGTAGAGTTTCATATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358686    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_000380.3-1210s21c1
Sequence:CCGGTGGTAGGTCAGCTACAAATTTCTCGAGAAATTTGTAGCTGACCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_000380.3-1242s21c1
Sequence:CCGGACCAAGGCAAACCCTAGATTGCTCGAGCAATCTAGGGTTTGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_000380.3-514s21c1
Sequence:CCGGGATGATAAACACAAGCTTATACTCGAGTATAAGCTTGTGTTTATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011728
VALIDATED
XPA MISSION shRNA Bacterial Glycerol Stock
xeroderma pigmentosum, complementation group A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011728.1-373s1c1
Sequence:CCGGGCCCGTCATGGAGTTTGATTACTCGAGTAATCAAACTCCATGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011728.1-770s1c1
Sequence:CCGGCGAGCAATAAGAAGCAGTGTACTCGAGTACACTGCTTCTTATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011728.1-571s1c1
Sequence:CCGGGCTCAGGTTCCTTGTGAAGAACTCGAGTTCTTCACAAGGAACCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011728.1-430s1c1
Sequence:CCGGCTCGTACCTTATGAACCACTTCTCGAGAAGTGGTTCATAAGGTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011728.1-616s1c1
Sequence:CCGGCGATATGAAGCTCTACCTAAACTCGAGTTTAGGTAGAGCTTCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011728.1-430s21c1
Sequence:CCGGCTCGTACCTTATGAACCACTTCTCGAGAAGTGGTTCATAAGGTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011728.1-616s21c1
Sequence:CCGGCGATATGAAGCTCTACCTAAACTCGAGTTTAGGTAGAGCTTCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011728.1-770s21c1
Sequence:CCGGCGAGCAATAAGAAGCAGTGTACTCGAGTACACTGCTTCTTATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011728.1-373s21c1
Sequence:CCGGGCCCGTCATGGAGTTTGATTACTCGAGTAATCAAACTCCATGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011728
VALIDATED
XPA MISSION shRNA shRNA Plasmid DNA
xeroderma pigmentosum, complementation group A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011728.1-373s1c1
Sequence:CCGGGCCCGTCATGGAGTTTGATTACTCGAGTAATCAAACTCCATGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011728.1-770s1c1
Sequence:CCGGCGAGCAATAAGAAGCAGTGTACTCGAGTACACTGCTTCTTATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011728.1-571s1c1
Sequence:CCGGGCTCAGGTTCCTTGTGAAGAACTCGAGTTCTTCACAAGGAACCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011728.1-430s1c1
Sequence:CCGGCTCGTACCTTATGAACCACTTCTCGAGAAGTGGTTCATAAGGTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011728.1-616s1c1
Sequence:CCGGCGATATGAAGCTCTACCTAAACTCGAGTTTAGGTAGAGCTTCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011728.1-430s21c1
Sequence:CCGGCTCGTACCTTATGAACCACTTCTCGAGAAGTGGTTCATAAGGTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011728.1-616s21c1
Sequence:CCGGCGATATGAAGCTCTACCTAAACTCGAGTTTAGGTAGAGCTTCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011728.1-770s21c1
Sequence:CCGGCGAGCAATAAGAAGCAGTGTACTCGAGTACACTGCTTCTTATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011728.1-373s21c1
Sequence:CCGGGCCCGTCATGGAGTTTGATTACTCGAGTAATCAAACTCCATGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011728
VALIDATED
XPA MISSION shRNA Lentiviral Transduction Particles
xeroderma pigmentosum, complementation group A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011728.1-373s1c1
Sequence:CCGGGCCCGTCATGGAGTTTGATTACTCGAGTAATCAAACTCCATGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011728.1-770s1c1
Sequence:CCGGCGAGCAATAAGAAGCAGTGTACTCGAGTACACTGCTTCTTATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011728.1-571s1c1
Sequence:CCGGGCTCAGGTTCCTTGTGAAGAACTCGAGTTCTTCACAAGGAACCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011728.1-430s1c1
Sequence:CCGGCTCGTACCTTATGAACCACTTCTCGAGAAGTGGTTCATAAGGTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011728.1-616s1c1
Sequence:CCGGCGATATGAAGCTCTACCTAAACTCGAGTTTAGGTAGAGCTTCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011728.1-430s21c1
Sequence:CCGGCTCGTACCTTATGAACCACTTCTCGAGAAGTGGTTCATAAGGTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011728.1-616s21c1
Sequence:CCGGCGATATGAAGCTCTACCTAAACTCGAGTTTAGGTAGAGCTTCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011728.1-770s21c1
Sequence:CCGGCGAGCAATAAGAAGCAGTGTACTCGAGTACACTGCTTCTTATTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011728.1-373s21c1
Sequence:CCGGGCCCGTCATGGAGTTTGATTACTCGAGTAATCAAACTCCATGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks