EMAIL THIS PAGE TO A FRIEND

XPC

xeroderma pigmentosum, complementation group C

Synonyms: RAD4 XP3 XPCC
UniProtKB ID: Q01831, B4DIP3, E9PH69, Q53GT7, Q96AX0
Gene ID:
Human(7508) Summary: This gene encodes a component of the nucleotide excision repair (NER) pathway. There are multiple components involved in the NER pathway, including Xeroderma pigmentosum (XP) A-G and V, Cockayne syndrome (CS) A and B, and trichothiodystrophy (TTD) group A, etc. This component, XPC, plays an important role in the early steps of global genome NER, especially in damage recognition, open complex formation, and repair protein complex formation. Mutations in this gene or some other NER components result in Xeroderma pigmentosum, a rare autosomal recessive disorder characterized by increased sensitivity to sunlight with the development of carcinomas at an early age. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(22591) xeroderma pigmentosum, complementation group C
Rat(312560) xeroderma pigmentosum, complementation group C
Zebrafish(541386) xeroderma pigmentosum, complementation group C
dog(476521) xeroderma pigmentosum, complementation group C
chicken(416039) xeroderma pigmentosum, complementation group C
domestic cat(101080440) xeroderma pigmentosum, complementation group C
Horse(100050424) xeroderma pigmentosum, complementation group C
naked mole-rat(101707002) xeroderma pigmentosum, complementation group C
Domestic Rabbit(100346279) xeroderma pigmentosum, complementation group C
domestic guinea pig(100719007) xeroderma pigmentosum, complementation group C
cow(524274) xeroderma pigmentosum, complementation group C
sheep(101109650) xeroderma pigmentosum, complementation group C
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004628 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004628 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004628 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009531 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009531 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009531 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004628 Rosetta Predictions human pricing
NM_001107874 Rosetta Predictions rat pricing
NM_009531 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086530 predicted 842
2 SASI_Hs01_00086531 predicted 1168
3 SASI_Hs02_00338027 predicted 1103
4 SASI_Hs01_00086532 predicted 958
5 SASI_Hs01_00086533 predicted 2497
6 SASI_Hs01_00086534 predicted 1764
7 SASI_Hs01_00086535 predicted 845
8 SASI_Hs01_00086536 predicted 1140
9 SASI_Hs01_00086537 predicted 895
10 SASI_Hs01_00086538 predicted 558
11 SASI_Hs01_00086539 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107874 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233135 predicted 1470
2 SASI_Rn02_00233136 predicted 2251
3 SASI_Rn02_00233137 predicted 2004
4 SASI_Rn02_00233138 predicted 1732
5 SASI_Rn02_00233139 predicted 760
6 SASI_Rn02_00233140 predicted 289
7 SASI_Rn02_00233141 predicted 2914
8 SASI_Rn02_00233142 predicted 744
9 SASI_Rn02_00233143 predicted 1772
10 SASI_Rn02_00233144 predicted 1997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009531 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145846 predicted 1501
2 SASI_Mm02_00316336 predicted 2792
3 SASI_Mm02_00316337 predicted 321
4 SASI_Mm01_00145848 predicted 2287
5 SASI_Mm01_00145849 predicted 1759
6 SASI_Mm01_00145850 predicted 2015
7 SASI_Mm01_00145852 predicted 1799
8 SASI_Mm02_00316338 predicted 562
9 SASI_Mm01_00145854 predicted 726
10 SASI_Mm02_00316339 predicted 326
11 SASI_Mm01_00145847 predicted 1484
12 SASI_Mm01_00145851 predicted 2332
13 SASI_Mm01_00145853 predicted 473
14 SASI_Mm01_00145855 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004628
VALIDATED
XPC MISSION shRNA Bacterial Glycerol Stock
xeroderma pigmentosum, complementation group C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004628.4-1083s21c1
Sequence:CCGGGCAACAGCAAAGGGAAAGAAACTCGAGTTTCTTTCCCTTTGCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004628.4-2007s21c1
Sequence:CCGGCCCACTGCCATTGGCTTATATCTCGAGATATAAGCCAATGGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004628.4-3271s21c1
Sequence:CCGGATGGAAGCCACCGGGAGATTTCTCGAGAAATCTCCCGGTGGCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004628.4-1766s21c1
Sequence:CCGGGCCTCTGACCTGTTACAAGTACTCGAGTACTTGTAACAGGTCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004628.4-989s21c1
Sequence:CCGGTGAGGAATTGGTCCATATATTCTCGAGAATATATGGACCAATTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004628.2-499s1c1
Sequence:CCGGCCAGTGGAGATAGAGATTGAACTCGAGTTCAATCTCTATCTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004628.2-1918s1c1
Sequence:CCGGCCCACTGCCATTGGCTTATATCTCGAGATATAAGCCAATGGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004628.2-2499s1c1
Sequence:CCGGGCAGGCAGTCATTGAAAGGAACTCGAGTTCCTTTCAATGACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004628.2-994s1c1
Sequence:CCGGGCAACAGCAAAGGGAAAGAAACTCGAGTTTCTTTCCCTTTGCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004628
VALIDATED
XPC MISSION shRNA shRNA Plasmid DNA
xeroderma pigmentosum, complementation group C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004628.4-1083s21c1
Sequence:CCGGGCAACAGCAAAGGGAAAGAAACTCGAGTTTCTTTCCCTTTGCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004628.4-2007s21c1
Sequence:CCGGCCCACTGCCATTGGCTTATATCTCGAGATATAAGCCAATGGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004628.4-3271s21c1
Sequence:CCGGATGGAAGCCACCGGGAGATTTCTCGAGAAATCTCCCGGTGGCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004628.4-1766s21c1
Sequence:CCGGGCCTCTGACCTGTTACAAGTACTCGAGTACTTGTAACAGGTCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004628.4-989s21c1
Sequence:CCGGTGAGGAATTGGTCCATATATTCTCGAGAATATATGGACCAATTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004628.2-499s1c1
Sequence:CCGGCCAGTGGAGATAGAGATTGAACTCGAGTTCAATCTCTATCTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004628.2-1918s1c1
Sequence:CCGGCCCACTGCCATTGGCTTATATCTCGAGATATAAGCCAATGGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004628.2-2499s1c1
Sequence:CCGGGCAGGCAGTCATTGAAAGGAACTCGAGTTCCTTTCAATGACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004628.2-994s1c1
Sequence:CCGGGCAACAGCAAAGGGAAAGAAACTCGAGTTTCTTTCCCTTTGCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004628
VALIDATED
XPC MISSION shRNA Lentiviral Transduction Particles
xeroderma pigmentosum, complementation group C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004628.4-1083s21c1
Sequence:CCGGGCAACAGCAAAGGGAAAGAAACTCGAGTTTCTTTCCCTTTGCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004628.4-2007s21c1
Sequence:CCGGCCCACTGCCATTGGCTTATATCTCGAGATATAAGCCAATGGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004628.4-3271s21c1
Sequence:CCGGATGGAAGCCACCGGGAGATTTCTCGAGAAATCTCCCGGTGGCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004628.4-1766s21c1
Sequence:CCGGGCCTCTGACCTGTTACAAGTACTCGAGTACTTGTAACAGGTCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004628.4-989s21c1
Sequence:CCGGTGAGGAATTGGTCCATATATTCTCGAGAATATATGGACCAATTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004628.2-499s1c1
Sequence:CCGGCCAGTGGAGATAGAGATTGAACTCGAGTTCAATCTCTATCTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004628.2-1918s1c1
Sequence:CCGGCCCACTGCCATTGGCTTATATCTCGAGATATAAGCCAATGGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004628.2-2499s1c1
Sequence:CCGGGCAGGCAGTCATTGAAAGGAACTCGAGTTCCTTTCAATGACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004628.2-994s1c1
Sequence:CCGGGCAACAGCAAAGGGAAAGAAACTCGAGTTTCTTTCCCTTTGCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009531
VALIDATED
XPC MISSION shRNA Bacterial Glycerol Stock
xeroderma pigmentosum, complementation group C
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009531.2-1892s21c1
Sequence:CCGGACCCTATCGGAGCCTACTTACCTCGAGGTAAGTAGGCTCCGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009531.2-2162s21c1
Sequence:CCGGGCTTGGAGAAGTGCCCTATAACTCGAGTTATAGGGCACTTCTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009531.2-722s1c1
Sequence:CCGGCAGTGGCTTCTATCGAAATAGCTCGAGCTATTTCGATAGAAGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009531.2-722s21c1
Sequence:CCGGCAGTGGCTTCTATCGAAATAGCTCGAGCTATTTCGATAGAAGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009531.2-961s21c1
Sequence:CCGGATGAAGAGTTGGTCCATATATCTCGAGATATATGGACCAACTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009531.1-2194s1c1
Sequence:CCGGGAAGAGTATCAGCCTCCTATACTCGAGTATAGGAGGCTGATACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009531.1-558s1c1
Sequence:CCGGGAGGATGATGAAGCGTTTCAACTCGAGTTGAAACGCTTCATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009531
VALIDATED
XPC MISSION shRNA shRNA Plasmid DNA
xeroderma pigmentosum, complementation group C
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009531.2-1892s21c1
Sequence:CCGGACCCTATCGGAGCCTACTTACCTCGAGGTAAGTAGGCTCCGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009531.2-2162s21c1
Sequence:CCGGGCTTGGAGAAGTGCCCTATAACTCGAGTTATAGGGCACTTCTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009531.2-722s1c1
Sequence:CCGGCAGTGGCTTCTATCGAAATAGCTCGAGCTATTTCGATAGAAGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009531.2-722s21c1
Sequence:CCGGCAGTGGCTTCTATCGAAATAGCTCGAGCTATTTCGATAGAAGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009531.2-961s21c1
Sequence:CCGGATGAAGAGTTGGTCCATATATCTCGAGATATATGGACCAACTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009531.1-2194s1c1
Sequence:CCGGGAAGAGTATCAGCCTCCTATACTCGAGTATAGGAGGCTGATACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009531.1-558s1c1
Sequence:CCGGGAGGATGATGAAGCGTTTCAACTCGAGTTGAAACGCTTCATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009531
VALIDATED
XPC MISSION shRNA Lentiviral Transduction Particles
xeroderma pigmentosum, complementation group C
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009531.2-1892s21c1
Sequence:CCGGACCCTATCGGAGCCTACTTACCTCGAGGTAAGTAGGCTCCGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009531.2-2162s21c1
Sequence:CCGGGCTTGGAGAAGTGCCCTATAACTCGAGTTATAGGGCACTTCTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009531.2-722s1c1
Sequence:CCGGCAGTGGCTTCTATCGAAATAGCTCGAGCTATTTCGATAGAAGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009531.2-722s21c1
Sequence:CCGGCAGTGGCTTCTATCGAAATAGCTCGAGCTATTTCGATAGAAGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009531.2-961s21c1
Sequence:CCGGATGAAGAGTTGGTCCATATATCTCGAGATATATGGACCAACTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009531.1-2194s1c1
Sequence:CCGGGAAGAGTATCAGCCTCCTATACTCGAGTATAGGAGGCTGATACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009531.1-558s1c1
Sequence:CCGGGAGGATGATGAAGCGTTTCAACTCGAGTTGAAACGCTTCATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks