EMAIL THIS PAGE TO A FRIEND

XPNPEP1

X-prolyl aminopeptidase (aminopeptidase P) 1, soluble

Synonyms: APP1 SAMP XPNPEP XPNPEPL XPNPEPL1
Gene ID:
Human(7511) Summary: This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
Mouse(170750) X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Rat(170751) X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Zebrafish(406253) X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Horse(100069118) X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
domestic cat(101091311) X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
dog(486880) X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
chicken(423886) X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
cow(513156) X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
sheep(101117381) X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
domestic guinea pig(100717674) X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Domestic Rabbit(100342148) X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
naked mole-rat(101698797) X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020383 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020383 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020383 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133216 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133216 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133216 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020383 Rosetta Predictions human pricing
NM_131913 Rosetta Predictions rat pricing
NM_133216 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117279 predicted 718
2 SASI_Hs01_00117280 predicted 1451
3 SASI_Hs01_00117281 predicted 1100
4 SASI_Hs01_00117282 predicted 811
5 SASI_Hs01_00117283 predicted 840
6 SASI_Hs01_00117284 predicted 1698
7 SASI_Hs01_00117285 predicted 1465
8 SASI_Hs01_00117286 predicted 1817
9 SASI_Hs01_00117287 predicted 821
10 SASI_Hs02_00353350 predicted 1812
11 SASI_Hs01_00117278 predicted 1850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_131913 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105883 predicted 1602
2 SASI_Rn01_00105884 predicted 1753
3 SASI_Rn01_00105885 predicted 1682
4 SASI_Rn02_00267544 predicted 297
5 SASI_Rn01_00105886 predicted 1839
6 SASI_Rn01_00105888 predicted 649
7 SASI_Rn02_00267545 predicted 1375
8 SASI_Rn01_00105889 predicted 1298
9 SASI_Rn02_00267546 predicted 404
10 SASI_Rn01_00105891 predicted 1479
11 SASI_Rn01_00105887 predicted 724
12 SASI_Rn01_00105890 predicted 441
13 SASI_Rn01_00105892 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087404 predicted 1678
2 SASI_Mm01_00087405 predicted 817
3 SASI_Mm01_00087406 predicted 379
4 SASI_Mm01_00087407 predicted 734
5 SASI_Mm01_00087408 predicted 1454
6 SASI_Mm02_00338418 predicted 1208
7 SASI_Mm01_00087409 predicted 1673
8 SASI_Mm01_00087410 predicted 1832
9 SASI_Mm01_00087411 predicted 762
10 SASI_Mm01_00087412 predicted 1562
11 SASI_Mm01_00087413 predicted 397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020383
VALIDATED
XPNPEP1 MISSION shRNA Bacterial Glycerol Stock
X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020383.2-2210s1c1
Sequence:CCGGGTTGAGAACAAGCCAAGAATACTCGAGTATTCTTGGCTTGTTCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020383.2-1137s1c1
Sequence:CCGGGCTCACATTAAAGATGCTGTTCTCGAGAACAGCATCTTTAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020383.2-1555s1c1
Sequence:CCGGCCCGTTCAGCTTTATGGGATTCTCGAGAATCCCATAAAGCTGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020383.2-501s1c1
Sequence:CCGGCCCTTGATCATTCCTACAGATCTCGAGATCTGTAGGAATGATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020383.3-1522s21c1
Sequence:CCGGACAGATGTGACGCGGACAATGCTCGAGCATTGTCCGCGTCACATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020383.3-941s21c1
Sequence:CCGGAGACGATCATGCTCTTCATTGCTCGAGCAATGAAGAGCATGATCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020383.3-358s21c1
Sequence:CCGGGCTCATCAGAGTGAGTATATTCTCGAGAATATACTCACTCTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020383.2-1821s1c2
Sequence:CCGGCCTCTAACATTGGTTCCAATTCTCGAGAATTGGAACCAATGTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020383
VALIDATED
XPNPEP1 MISSION shRNA shRNA Plasmid DNA
X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020383.2-2210s1c1
Sequence:CCGGGTTGAGAACAAGCCAAGAATACTCGAGTATTCTTGGCTTGTTCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020383.2-1137s1c1
Sequence:CCGGGCTCACATTAAAGATGCTGTTCTCGAGAACAGCATCTTTAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020383.2-1555s1c1
Sequence:CCGGCCCGTTCAGCTTTATGGGATTCTCGAGAATCCCATAAAGCTGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020383.2-501s1c1
Sequence:CCGGCCCTTGATCATTCCTACAGATCTCGAGATCTGTAGGAATGATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020383.3-1522s21c1
Sequence:CCGGACAGATGTGACGCGGACAATGCTCGAGCATTGTCCGCGTCACATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020383.3-941s21c1
Sequence:CCGGAGACGATCATGCTCTTCATTGCTCGAGCAATGAAGAGCATGATCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020383.3-358s21c1
Sequence:CCGGGCTCATCAGAGTGAGTATATTCTCGAGAATATACTCACTCTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020383.2-1821s1c2
Sequence:CCGGCCTCTAACATTGGTTCCAATTCTCGAGAATTGGAACCAATGTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020383
VALIDATED
XPNPEP1 MISSION shRNA Lentiviral Transduction Particles
X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020383.2-2210s1c1
Sequence:CCGGGTTGAGAACAAGCCAAGAATACTCGAGTATTCTTGGCTTGTTCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020383.2-1137s1c1
Sequence:CCGGGCTCACATTAAAGATGCTGTTCTCGAGAACAGCATCTTTAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020383.2-1555s1c1
Sequence:CCGGCCCGTTCAGCTTTATGGGATTCTCGAGAATCCCATAAAGCTGAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020383.2-501s1c1
Sequence:CCGGCCCTTGATCATTCCTACAGATCTCGAGATCTGTAGGAATGATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020383.3-1522s21c1
Sequence:CCGGACAGATGTGACGCGGACAATGCTCGAGCATTGTCCGCGTCACATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020383.3-941s21c1
Sequence:CCGGAGACGATCATGCTCTTCATTGCTCGAGCAATGAAGAGCATGATCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020383.3-358s21c1
Sequence:CCGGGCTCATCAGAGTGAGTATATTCTCGAGAATATACTCACTCTGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020383.2-1821s1c2
Sequence:CCGGCCTCTAACATTGGTTCCAATTCTCGAGAATTGGAACCAATGTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133216
VALIDATED
XPNPEP1 MISSION shRNA Bacterial Glycerol Stock
X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133216.2-1123s1c1
Sequence:CCGGGCTCACATTAAAGATGCCGTTCTCGAGAACGGCATCTTTAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133216.2-1793s1c1
Sequence:CCGGGCCTGACCTTTGAACCTCTAACTCGAGTTAGAGGTTCAAAGGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133216.2-501s1c1
Sequence:CCGGCACAGATTACTGGAAGAAGATCTCGAGATCTTCTTCCAGTAATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133216.2-1553s1c1
Sequence:CCGGTGTGGGATTCTGGTCTGGATTCTCGAGAATCCAGACCAGAATCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133216.2-735s1c1
Sequence:CCGGCGAGATTGCATGGCTGTTCAACTCGAGTTGAACAGCCATGCAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133216.2-501s21c1
Sequence:CCGGCACAGATTACTGGAAGAAGATCTCGAGATCTTCTTCCAGTAATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133216.2-735s21c1
Sequence:CCGGCGAGATTGCATGGCTGTTCAACTCGAGTTGAACAGCCATGCAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133216.2-1793s21c1
Sequence:CCGGGCCTGACCTTTGAACCTCTAACTCGAGTTAGAGGTTCAAAGGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133216.2-1553s21c1
Sequence:CCGGTGTGGGATTCTGGTCTGGATTCTCGAGAATCCAGACCAGAATCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133216
VALIDATED
XPNPEP1 MISSION shRNA shRNA Plasmid DNA
X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133216.2-1123s1c1
Sequence:CCGGGCTCACATTAAAGATGCCGTTCTCGAGAACGGCATCTTTAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133216.2-1793s1c1
Sequence:CCGGGCCTGACCTTTGAACCTCTAACTCGAGTTAGAGGTTCAAAGGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133216.2-501s1c1
Sequence:CCGGCACAGATTACTGGAAGAAGATCTCGAGATCTTCTTCCAGTAATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133216.2-1553s1c1
Sequence:CCGGTGTGGGATTCTGGTCTGGATTCTCGAGAATCCAGACCAGAATCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133216.2-735s1c1
Sequence:CCGGCGAGATTGCATGGCTGTTCAACTCGAGTTGAACAGCCATGCAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133216.2-501s21c1
Sequence:CCGGCACAGATTACTGGAAGAAGATCTCGAGATCTTCTTCCAGTAATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133216.2-735s21c1
Sequence:CCGGCGAGATTGCATGGCTGTTCAACTCGAGTTGAACAGCCATGCAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133216.2-1793s21c1
Sequence:CCGGGCCTGACCTTTGAACCTCTAACTCGAGTTAGAGGTTCAAAGGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133216.2-1553s21c1
Sequence:CCGGTGTGGGATTCTGGTCTGGATTCTCGAGAATCCAGACCAGAATCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133216
VALIDATED
XPNPEP1 MISSION shRNA Lentiviral Transduction Particles
X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133216.2-1123s1c1
Sequence:CCGGGCTCACATTAAAGATGCCGTTCTCGAGAACGGCATCTTTAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133216.2-1793s1c1
Sequence:CCGGGCCTGACCTTTGAACCTCTAACTCGAGTTAGAGGTTCAAAGGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133216.2-501s1c1
Sequence:CCGGCACAGATTACTGGAAGAAGATCTCGAGATCTTCTTCCAGTAATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133216.2-1553s1c1
Sequence:CCGGTGTGGGATTCTGGTCTGGATTCTCGAGAATCCAGACCAGAATCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133216.2-735s1c1
Sequence:CCGGCGAGATTGCATGGCTGTTCAACTCGAGTTGAACAGCCATGCAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133216.2-501s21c1
Sequence:CCGGCACAGATTACTGGAAGAAGATCTCGAGATCTTCTTCCAGTAATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133216.2-735s21c1
Sequence:CCGGCGAGATTGCATGGCTGTTCAACTCGAGTTGAACAGCCATGCAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133216.2-1793s21c1
Sequence:CCGGGCCTGACCTTTGAACCTCTAACTCGAGTTAGAGGTTCAAAGGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133216.2-1553s21c1
Sequence:CCGGTGTGGGATTCTGGTCTGGATTCTCGAGAATCCAGACCAGAATCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks