EMAIL THIS PAGE TO A FRIEND

XPNPEP2

X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound

Synonyms: APP2
UniProtKB ID: O43895, A0AV16, O75994
Gene ID:
Human(7512) Summary: Aminopeptidase P is a hydrolase specific for N-terminal imido bonds, which are common to several collagen degradation products, neuropeptides, vasoactive peptides, and cytokines. Structurally, the enzyme is a member of the 'pita bread fold' family and occurs in mammalian tissues in both soluble and GPI-anchored membrane-bound forms. A membrane-bound and soluble form of this enzyme have been identified as products of two separate genes. [provided by RefSeq, Jul 2008]
Mouse(170745) X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
Rat(117522) X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
naked mole-rat(101724021) X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
Domestic Rabbit(100339097) X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
domestic guinea pig(100732623) X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
cow(504822) X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
sheep(101120054) X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
Zebrafish(394007) X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
domestic cat(101090244) X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
Horse(100059029) X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
dog(492124) X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
chicken(422137) X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133213 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133213 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133213 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003399 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003399 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003399 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003399 Rosetta Predictions human pricing
NM_057155 Rosetta Predictions rat pricing
NM_133213 Rosetta Predictions mouse pricing
NM_178074 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215627 predicted 2024
2 SASI_Hs01_00215628 predicted 2012
3 SASI_Hs01_00215629 predicted 1666
4 SASI_Hs01_00215631 predicted 1464
5 SASI_Hs01_00215632 predicted 1992
6 SASI_Hs01_00215633 predicted 643
7 SASI_Hs01_00215634 predicted 1152
8 SASI_Hs01_00215635 predicted 1196
9 SASI_Hs02_00335587 predicted 1082
10 SASI_Hs01_00215636 predicted 1227
11 SASI_Hs01_00215630 predicted 1715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084996 predicted 820
2 SASI_Rn01_00084997 predicted 913
3 SASI_Rn01_00084998 predicted 1678
4 SASI_Rn01_00085000 predicted 1026
5 SASI_Rn01_00085001 predicted 949
6 SASI_Rn01_00085002 predicted 429
7 SASI_Rn01_00085003 predicted 919
8 SASI_Rn01_00085004 predicted 1994
9 SASI_Rn01_00085005 predicted 1416
10 SASI_Rn02_00267121 predicted 2066
11 SASI_Rn01_00084999 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133213 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338409 predicted 548
2 SASI_Mm02_00338410 predicted 1332
3 SASI_Mm01_00110548 predicted 1253
4 SASI_Mm01_00110549 predicted 2067
5 SASI_Mm02_00338411 predicted 517
6 SASI_Mm02_00338412 predicted 1849
7 SASI_Mm01_00110550 predicted 2103
8 SASI_Mm02_00338413 predicted 491
9 SASI_Mm01_00110554 predicted 1087
10 SASI_Mm02_00338414 predicted 1798
11 SASI_Mm01_00110551 predicted 2507
12 SASI_Mm01_00110552 predicted 879
13 SASI_Mm01_00110553 predicted 2660
14 SASI_Mm01_00110555 predicted 2540
15 SASI_Mm01_00110556 predicted 2546
16 SASI_Mm01_00110557 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087972 predicted 1068
2 SASI_Mm01_00087973 predicted 1874
3 SASI_Mm01_00087974 predicted 1921
4 SASI_Mm01_00087975 predicted 2462
5 SASI_Mm01_00087976 predicted 841
6 SASI_Mm01_00087977 predicted 900
7 SASI_Mm01_00087978 predicted 2415
8 SASI_Mm01_00087979 predicted 2497
9 SASI_Mm01_00087980 predicted 2511
10 SASI_Mm01_00087981 predicted 968
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133213
XPNPEP2 MISSION shRNA Bacterial Glycerol Stock
X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000031855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133213.1-942s1c1
Sequence:CCGGCGAAGCTATATGGAGCACCATCTCGAGATGGTGCTCCATATAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133213.1-1139s1c1
Sequence:CCGGCCTGAATACAAACTGCACATTCTCGAGAATGTGCAGTTTGTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133213.1-1877s1c1
Sequence:CCGGGCCAGTGGGATTCCAGTATAACTCGAGTTATACTGGAATCCCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133213.1-2106s1c1
Sequence:CCGGCAGTACCTGAACCGCTACTATCTCGAGATAGTAGCGGTTCAGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133213
XPNPEP2 MISSION shRNA shRNA Plasmid DNA
X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000031855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133213.1-942s1c1
Sequence:CCGGCGAAGCTATATGGAGCACCATCTCGAGATGGTGCTCCATATAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133213.1-1139s1c1
Sequence:CCGGCCTGAATACAAACTGCACATTCTCGAGAATGTGCAGTTTGTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133213.1-1877s1c1
Sequence:CCGGGCCAGTGGGATTCCAGTATAACTCGAGTTATACTGGAATCCCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133213.1-2106s1c1
Sequence:CCGGCAGTACCTGAACCGCTACTATCTCGAGATAGTAGCGGTTCAGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133213
XPNPEP2 MISSION shRNA Lentiviral Transduction Particles
X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000031855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133213.1-942s1c1
Sequence:CCGGCGAAGCTATATGGAGCACCATCTCGAGATGGTGCTCCATATAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133213.1-1139s1c1
Sequence:CCGGCCTGAATACAAACTGCACATTCTCGAGAATGTGCAGTTTGTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133213.1-1877s1c1
Sequence:CCGGGCCAGTGGGATTCCAGTATAACTCGAGTTATACTGGAATCCCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133213.1-2106s1c1
Sequence:CCGGCAGTACCTGAACCGCTACTATCTCGAGATAGTAGCGGTTCAGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003399
XPNPEP2 MISSION shRNA Bacterial Glycerol Stock
X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003399.3-857s1c1
Sequence:CCGGCGGTTCCAAATCAACCCATTTCTCGAGAAATGGGTTGATTTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003399.3-1681s1c1
Sequence:CCGGGCCTTTCAGAAGGAGGCATATCTCGAGATATGCCTCCTTCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003399.3-1116s1c1
Sequence:CCGGCGAAACCTTGAGCTATCTGAACTCGAGTTCAGATAGCTCAAGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003399.3-2097s1c1
Sequence:CCGGCCAGTACCTGAATCGCTACTACTCGAGTAGTAGCGATTCAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003399.3-1804s1c1
Sequence:CCGGGCTGGTCTCAATTATGGTCATCTCGAGATGACCATAATTGAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003399
XPNPEP2 MISSION shRNA shRNA Plasmid DNA
X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003399.3-857s1c1
Sequence:CCGGCGGTTCCAAATCAACCCATTTCTCGAGAAATGGGTTGATTTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003399.3-1681s1c1
Sequence:CCGGGCCTTTCAGAAGGAGGCATATCTCGAGATATGCCTCCTTCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003399.3-1116s1c1
Sequence:CCGGCGAAACCTTGAGCTATCTGAACTCGAGTTCAGATAGCTCAAGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003399.3-2097s1c1
Sequence:CCGGCCAGTACCTGAATCGCTACTACTCGAGTAGTAGCGATTCAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003399.3-1804s1c1
Sequence:CCGGGCTGGTCTCAATTATGGTCATCTCGAGATGACCATAATTGAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003399
XPNPEP2 MISSION shRNA Lentiviral Transduction Particles
X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003399.3-857s1c1
Sequence:CCGGCGGTTCCAAATCAACCCATTTCTCGAGAAATGGGTTGATTTGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003399.3-1681s1c1
Sequence:CCGGGCCTTTCAGAAGGAGGCATATCTCGAGATATGCCTCCTTCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003399.3-1116s1c1
Sequence:CCGGCGAAACCTTGAGCTATCTGAACTCGAGTTCAGATAGCTCAAGGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003399.3-2097s1c1
Sequence:CCGGCCAGTACCTGAATCGCTACTACTCGAGTAGTAGCGATTCAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003399.3-1804s1c1
Sequence:CCGGGCTGGTCTCAATTATGGTCATCTCGAGATGACCATAATTGAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks