EMAIL THIS PAGE TO A FRIEND

XPNPEP3

X-prolyl aminopeptidase (aminopeptidase P) 3, putative

Synonyms: APP3 NPHPL1
Gene ID:
Human(63929) Summary: The protein encoded by this gene belongs to the family of X-pro-aminopeptidases that utilize a metal cofactor, and remove the N-terminal amino acid from peptides with a proline residue in the penultimate position. This protein has been shown to localize to the mitochondria of renal cells, and have a role in ciliary function. Mutations in this gene are associated with nephronophthisis-like nephropathy-1. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene, however, expression of some of these isoforms in vivo is not known.[provided by RefSeq, Mar 2011]
Mouse(321003) X-prolyl aminopeptidase (aminopeptidase P) 3, putative
Rat(685823) X-prolyl aminopeptidase (aminopeptidase P) 3, putative
Zebrafish(573360) X-prolyl aminopeptidase (aminopeptidase P) 3, putative
Horse(100055543) X-prolyl aminopeptidase (aminopeptidase P) 3, putative
dog(481237) X-prolyl aminopeptidase (aminopeptidase P) 3, putative
domestic cat(101087247) X-prolyl aminopeptidase (aminopeptidase P) 3, putative
chicken(418002) X-prolyl aminopeptidase (aminopeptidase P) 3, putative
cow(539202) X-prolyl aminopeptidase (aminopeptidase P) 3, putative
sheep(101109347) X-prolyl aminopeptidase (aminopeptidase P) 3, putative
domestic guinea pig(100714484) X-prolyl aminopeptidase (aminopeptidase P) 3, putative
Domestic Rabbit(100358209) X-prolyl aminopeptidase (aminopeptidase P) 3, putative
naked mole-rat(101713567) X-prolyl aminopeptidase (aminopeptidase P) 3, putative
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177310 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177310 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177310 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022098 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022098 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022098 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026351 MISSION® esiRNA esiRNA targeting mouse Xpnpep3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022098 Rosetta Predictions human pricing
NM_001130582 Rosetta Predictions rat pricing
NM_177310 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232377 predicted 829
2 SASI_Hs01_00232378 predicted 886
3 SASI_Hs01_00232379 predicted 1587
4 SASI_Hs01_00232380 predicted 419
5 SASI_Hs02_00355488 predicted 818
6 SASI_Hs01_00232381 predicted 607
7 SASI_Hs01_00232382 predicted 1009
8 SASI_Hs01_00232383 predicted 1568
9 SASI_Hs01_00232384 predicted 1537
10 SASI_Hs01_00232386 predicted 793
11 SASI_Hs01_00232385 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130582 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255989 predicted 1397
2 SASI_Rn02_00255990 predicted 667
3 SASI_Rn02_00255991 predicted 1334
4 SASI_Rn02_00255992 predicted 376
5 SASI_Rn02_00255993 predicted 1033
6 SASI_Rn02_00255994 predicted 389
7 SASI_Rn02_00255995 predicted 1043
8 SASI_Rn02_00255996 predicted 712
9 SASI_Rn02_00255997 predicted 278
10 SASI_Rn02_00255998 predicted 1415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167360 predicted 856
2 SASI_Mm01_00167361 predicted 627
3 SASI_Mm01_00167362 predicted 329
4 SASI_Mm01_00167363 predicted 1032
5 SASI_Mm01_00167366 predicted 1074
6 SASI_Mm01_00167367 predicted 1032
7 SASI_Mm01_00167368 predicted 670
8 SASI_Mm01_00167369 predicted 234
9 SASI_Mm02_00347385 predicted 1113
10 SASI_Mm02_00347386 predicted 417
11 SASI_Mm01_00167364 predicted 260
12 SASI_Mm01_00167365 predicted 1189
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177310
VALIDATED
XPNPEP3 MISSION shRNA Bacterial Glycerol Stock
X-prolyl aminopeptidase (aminopeptidase P) 3, putative
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177310.2-859s1c1
Sequence:CCGGGCTCCGATAGATGAAGCCTTTCTCGAGAAAGGCTTCATCTATCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177310.2-628s1c1
Sequence:CCGGGAGACGAACATGGTTTGGTATCTCGAGATACCAAACCATGTTCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177310.2-104s1c1
Sequence:CCGGGCATGTCATGTTTACAGCGAACTCGAGTTCGCTGTAAACATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177310.2-874s1c1
Sequence:CCGGGCCTTTCTTTACGCGAAGTTTCTCGAGAAACTTCGCGTAAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177310.2-144s1c1
Sequence:CCGGGCCGGTAAAGAAGATTCCAAACTCGAGTTTGGAATCTTCTTTACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177310
VALIDATED
XPNPEP3 MISSION shRNA shRNA Plasmid DNA
X-prolyl aminopeptidase (aminopeptidase P) 3, putative
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177310.2-859s1c1
Sequence:CCGGGCTCCGATAGATGAAGCCTTTCTCGAGAAAGGCTTCATCTATCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177310.2-628s1c1
Sequence:CCGGGAGACGAACATGGTTTGGTATCTCGAGATACCAAACCATGTTCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177310.2-104s1c1
Sequence:CCGGGCATGTCATGTTTACAGCGAACTCGAGTTCGCTGTAAACATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177310.2-874s1c1
Sequence:CCGGGCCTTTCTTTACGCGAAGTTTCTCGAGAAACTTCGCGTAAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177310.2-144s1c1
Sequence:CCGGGCCGGTAAAGAAGATTCCAAACTCGAGTTTGGAATCTTCTTTACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177310
VALIDATED
XPNPEP3 MISSION shRNA Lentiviral Transduction Particles
X-prolyl aminopeptidase (aminopeptidase P) 3, putative
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177310.2-859s1c1
Sequence:CCGGGCTCCGATAGATGAAGCCTTTCTCGAGAAAGGCTTCATCTATCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177310.2-628s1c1
Sequence:CCGGGAGACGAACATGGTTTGGTATCTCGAGATACCAAACCATGTTCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177310.2-104s1c1
Sequence:CCGGGCATGTCATGTTTACAGCGAACTCGAGTTCGCTGTAAACATGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177310.2-874s1c1
Sequence:CCGGGCCTTTCTTTACGCGAAGTTTCTCGAGAAACTTCGCGTAAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177310.2-144s1c1
Sequence:CCGGGCCGGTAAAGAAGATTCCAAACTCGAGTTTGGAATCTTCTTTACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022098
VALIDATED
XPNPEP3 MISSION shRNA Bacterial Glycerol Stock
X-prolyl aminopeptidase (aminopeptidase P) 3, putative
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_022098.2-1918s1c1
Sequence:CCGGGCATTCCAGTTAACACATTTACTCGAGTAAATGTGTTAACTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022098.2-398s1c1
Sequence:CCGGCCCTACATACTACATGAGCAACTCGAGTTGCTCATGTAGTATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022098.2-287s1c1
Sequence:CCGGAGGACTATCTCAGGTGGAATACTCGAGTATTCCACCTGAGATAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022098.2-1261s1c1
Sequence:CCGGCCCTGATAGGACAGAAGCTTACTCGAGTAAGCTTCTGTCCTATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022098.2-1422s1c1
Sequence:CCGGCCTGGGATGGTAATCACAATTCTCGAGAATTGTGATTACCATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022098.2-311s21c1
Sequence:CCGGACTTCGCAGACACAAACTAATCTCGAGATTAGTTTGTGTCTGCGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022098.2-560s21c1
Sequence:CCGGAGATCCCAGTCGAGAACTTTGCTCGAGCAAAGTTCTCGACTGGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022098.2-2115s21c1
Sequence:CCGGGTAACTCCTCCCTACCTATTCCTCGAGGAATAGGTAGGGAGGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022098.2-894s21c1
Sequence:CCGGGAAACCATGTTCACCAGTAAACTCGAGTTTACTGGTGAACATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022098.2-1188s21c1
Sequence:CCGGGAGATCCAAAGAGATTGTTTGCTCGAGCAAACAATCTCTTTGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022098.2-1005s21c1
Sequence:CCGGGCTGGTGGTAATCGGTCAAACCTCGAGGTTTGACCGATTACCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022098
VALIDATED
XPNPEP3 MISSION shRNA shRNA Plasmid DNA
X-prolyl aminopeptidase (aminopeptidase P) 3, putative
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_022098.2-1918s1c1
Sequence:CCGGGCATTCCAGTTAACACATTTACTCGAGTAAATGTGTTAACTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022098.2-398s1c1
Sequence:CCGGCCCTACATACTACATGAGCAACTCGAGTTGCTCATGTAGTATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022098.2-287s1c1
Sequence:CCGGAGGACTATCTCAGGTGGAATACTCGAGTATTCCACCTGAGATAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022098.2-1261s1c1
Sequence:CCGGCCCTGATAGGACAGAAGCTTACTCGAGTAAGCTTCTGTCCTATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022098.2-1422s1c1
Sequence:CCGGCCTGGGATGGTAATCACAATTCTCGAGAATTGTGATTACCATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022098.2-311s21c1
Sequence:CCGGACTTCGCAGACACAAACTAATCTCGAGATTAGTTTGTGTCTGCGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022098.2-560s21c1
Sequence:CCGGAGATCCCAGTCGAGAACTTTGCTCGAGCAAAGTTCTCGACTGGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022098.2-2115s21c1
Sequence:CCGGGTAACTCCTCCCTACCTATTCCTCGAGGAATAGGTAGGGAGGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022098.2-894s21c1
Sequence:CCGGGAAACCATGTTCACCAGTAAACTCGAGTTTACTGGTGAACATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022098.2-1188s21c1
Sequence:CCGGGAGATCCAAAGAGATTGTTTGCTCGAGCAAACAATCTCTTTGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022098.2-1005s21c1
Sequence:CCGGGCTGGTGGTAATCGGTCAAACCTCGAGGTTTGACCGATTACCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022098
VALIDATED
XPNPEP3 MISSION shRNA Lentiviral Transduction Particles
X-prolyl aminopeptidase (aminopeptidase P) 3, putative
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_022098.2-1918s1c1
Sequence:CCGGGCATTCCAGTTAACACATTTACTCGAGTAAATGTGTTAACTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022098.2-398s1c1
Sequence:CCGGCCCTACATACTACATGAGCAACTCGAGTTGCTCATGTAGTATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022098.2-287s1c1
Sequence:CCGGAGGACTATCTCAGGTGGAATACTCGAGTATTCCACCTGAGATAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022098.2-1261s1c1
Sequence:CCGGCCCTGATAGGACAGAAGCTTACTCGAGTAAGCTTCTGTCCTATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022098.2-1422s1c1
Sequence:CCGGCCTGGGATGGTAATCACAATTCTCGAGAATTGTGATTACCATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022098.2-311s21c1
Sequence:CCGGACTTCGCAGACACAAACTAATCTCGAGATTAGTTTGTGTCTGCGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022098.2-560s21c1
Sequence:CCGGAGATCCCAGTCGAGAACTTTGCTCGAGCAAAGTTCTCGACTGGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022098.2-2115s21c1
Sequence:CCGGGTAACTCCTCCCTACCTATTCCTCGAGGAATAGGTAGGGAGGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022098.2-894s21c1
Sequence:CCGGGAAACCATGTTCACCAGTAAACTCGAGTTTACTGGTGAACATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022098.2-1188s21c1
Sequence:CCGGGAGATCCAAAGAGATTGTTTGCTCGAGCAAACAATCTCTTTGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022098.2-1005s21c1
Sequence:CCGGGCTGGTGGTAATCGGTCAAACCTCGAGGTTTGACCGATTACCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks